Biology and Genetics

1. 2. 3. 4. Choose the description that closely matches the rock type, also what

1. 2. 3. 4. Choose the description that closely matches the rock type, also what is the name of the rock? his is a dark gra to black, inely crystal ne volcanic rock that contains …

1. 2. 3. A pseudocoelom _________. A. Does not provide the benefits of a body ca

1. 2. 3.  A pseudocoelom _________. A. Does not provide the benefits of a body cavity because it’s not a true coelom.   B. Develops from within the mesoderm   C. Can help in movem…

1. 2. 3. Prokaryotic ribosomes have subunit A) 60S B) 80S C) 50S D) 40S In eukar

1. 2. 3. Prokaryotic ribosomes have subunit A) 60S B) 80S C) 50S D) 40S In eukaryotes lipids are synthesized by A) SER B) RER C) Golgi apparatus D) nucleolus The hydrophobic barri…

1. 2. 3. The attempt to distract the working classes from union or political org

1. 2. 3. The attempt to distract the working classes from union or political organizing, which many saw as dangerous to social order 4. William Morris 5. German Kaiser William I 6…

1. 2. 3. What are some of the limitations of PCR? Give three important character

1. 2. 3. What are some of the limitations of PCR? Give three important characteristics of cloning vectors. Briefly describe two different methods for inserting foreign DNA into pl…

1. 2. Incorrect Question 1 0/1 pts Our global temperature has increased and will

1. 2. Incorrect Question 1 0/1 pts Our global temperature has increased and will increase further by 2100 but that warming is not distribute evenly. Which of the following would N…

1. 2. Skin cancer are thought to occur when genetic material is damaged by sunli

1. 2. Skin cancer are thought to occur when genetic material is damaged by sunlight. Chemically, what must happen to DNA for sunlight to cause genetic damage? 2. Using your answer…

1. 2. Turn in this comp Attach your originá (Amoeba, Parameciu magnification (su

1. 2. Turn in this comp Attach your originá (Amoeba, Parameciu magnification (such as 100x) and any observations you ma kin, cheek cells, Elodea, and at least one of the single-ce…

1. 3 pt) Vinuses are described as non-living because they A. don\'t metabolize B

1. 3 pt) Vinuses are described as non-living because they A. don't metabolize B. aren't organized on a cellular level C. don't respond to stimuli D. all of the above 2. (3 pt) A b…

1. 3-years old boy develop sinusitis from his original rhinitis, which later con

1. 3-years old boy develop sinusitis from his original rhinitis, which later converts into a severe pharyngitis and laryngitis. Explain what may happen if his otitis continue untr…

1. 3.04 g of aluminum reacts with 7.42 g of iodine to form aluminum iodide. hen

1. 3.04 g of aluminum reacts with 7.42 g of iodine to form aluminum iodide. hen the reaction is complete, how many grams of each species are predicted to be present in the reactio…

1. 39 red eyed males, 83 red eyed females, and 42 white eyed males. Assuming tha

1. 39 red eyed males, 83 red eyed females, and 42 white eyed males. Assuming that all genotypes from this cross should have equal survival rates, what are the genotypes of the par…

1. 40 points Consider the reaction A +2B>C, with an overall rate law: a. d[C] -=

1. 40 points Consider the reaction A +2B>C, with an overall rate law: a. d[C] -= Kobs The following experimental data are obtained for this reaction: (i) For [AJo-1 M and [BJo-…

1. 6 FADH2 are produced in Krebs cycle. True or False? 2. An allosteric ________

1. 6 FADH2 are produced in Krebs cycle. True or False? 2. An allosteric _____________ stabilizes an enzymes active site by binding to a separate site that is not the active site. …

1. 7.0 mL of a 0.45 M Cu?\" solution was diluted with H20 to a total volume of 1

1. 7.0 mL of a 0.45 M Cu?" solution was diluted with H20 to a total volume of 18.0 ml. What is the molar concentration of Cu2+ molarity Submit Arswer Tries O/2 2. A Beer's law pio…

1. : lymphoid nodules (Peyer\'s patches) give this part of the small intestine a

1. : lymphoid nodules (Peyer's patches) give this part of the small intestine an immune function 2. : double layer of peritoneum; sheet of 2 fused serous membranes that enclose bl…

1. A (blank) can be used to measure this pressure, which is (blank) at sea level

1. A (blank) can be used to measure this pressure, which is (blank) at sea level. Select one: a. 29.92 inches of mercury, barometer b. barometer, 29.92 inches of mercury c. barome…

1. A ) Explain how geography, mass extinctions and adaptive radiation help expla

1. A) Explain how geography, mass extinctions and adaptive radiation help explain the diversity of living organisms. B) Explain how changes in development can explain the evolutio…

1. A 1 m tall 3-year old firl and her isometrically scaled up 2 m tall father ar

1. A 1 m tall 3-year old firl and her isometrically scaled up 2 m tall father are running barefoot down a gravel beach. The daughter is running along cheerfully, but her father's …

1. A 10 kg bowling ball is rolling down the lane at 5 m/s when it collides with

1. A 10 kg bowling ball is rolling down the lane at 5 m/s when it collides with a stationary pin. The pin flies straight at 8 m/s, and the bowling ball continues rolling forward a…

1. A 16-year-old male has been admitted to the nursing unit after breaking his l

1. A 16-year-old male has been admitted to the nursing unit after breaking his leg in a car accident. He seems sullen and just wants to watch TV. He answers the nurse’s questions …

1. A 20 year old male complains of sudden onset shortness of breath at 24 times

1. A 20 year old male complains of sudden onset shortness of breath at 24 times per minute and his pulse aximetry is 85% aCoach him on slowing his rate of respiration bApply oxyge…

1. A 23-y/o female comes in with her newborn infant (born at home without proper

1. A 23-y/o female comes in with her newborn infant (born at home without proper medical attention). She says her infant has an eye infection and she has vaginitis. Culturing from…

1. A 32-year-old woman was admitted to the hospital with acute gastrointestinal

1. A 32-year-old woman was admitted to the hospital with acute gastrointestinal bleeding. Her hematocrit was 0.16 (16%) (reference range 0.33-0.43 [33%-43%). Pretransfusion testin…

1. A 33 year old man, a new admission from the medical-surgical unit to the step

1.     A 33 year old man, a new admission from the medical-surgical unit to the step-down critical care unit, underwent a thyroidectomy 2 days ago. While reviewing the orders, you…

1. A 4.00 L flask at 25.0 o C contains argon at a partial pressure of 0.0850 atm

1. A 4.00 L flask at 25.0 oC contains argon at a partial pressure of 0.0850 atm. What would be the partial pressure of argon after we add 1.00 g of argon gas to the flask without …

1. A 48-year-old man asks his physician for a prescription for sildenafil to imp

1. A 48-year-old man asks his physician for a prescription for sildenafil to improve his sexual performance. Because of risks from a serious drug interaction, this drug should not…

1. A 66-year-old woman complains of high fever, and nonproductive cough of 2 day

1. A 66-year-old woman complains of high fever, and nonproductive cough of 2 days’ duration. She is fatigued also. She says that this is the second time in two years that she has …

1. A 71-year-old male patient comes to the hospital after having been previously

1. A 71-year-old male patient comes to the hospital after having been previously diagnosed with benign prostatic hypertrophy with urinary obstruction. Due to this condition, the p…

1. A DNA strand has the following sequence: 5’-GATCCCGATCCGCATACATTTACC -3’ a) I

1. A DNA strand has the following sequence: 5’-GATCCCGATCCGCATACATTTACC -3’ a) If this strand is being used as a template strand, in which direction would DNA polymerase slide alo…

1. A Particular DNA base sequence transcribed into mRNA is TTATCTTCGGGAGAGAAAACA

1. A Particular DNA base sequence transcribed into mRNA is TTATCTTCGGGAGAGAAAACA (a) If reading begins at the left, what amino acids are coded by this sequence? (Note: the initiat…

1. A Rh negative woman gives birth to her first child who is Rh positive with no

1. A Rh negative woman gives birth to her first child who is Rh positive with no complications. When she becomes pregnant with her second child, her doctor gives her an injection …

1. A Rh negative woman gives birth to her first child who is Rh positive with no

1. A Rh negative woman gives birth to her first child who is Rh positive with no complications. When she becomes pregnant with her second child, her doctor gives her an injection …

1. A Sanger dideoxy approach was used to determine the sequence of a gene X. Res

1. A Sanger dideoxy approach was used to determine the sequence of a gene X. Results of the DNA sequencing were shown below on the gel. Samples were loaded on the top of the gel. …

1. A Sanger dideoxy approach was used to determine the sequence of a gene X. Res

1. A Sanger dideoxy approach was used to determine the sequence of a gene X. Results of the DNA sequencing were shown below on the gel. Samples were loaded on the top of the gel. …

1. A When the reaction quotient, Q , has a larger value than the equilibrium con

1. A When the reaction quotient, Q , has a larger value than the equilibrium constant the reaction is at equilibrium B. If the reaction quotient is infinity, there are just produc…

1. A biologist collects seeds from a pale yellow sunflower in his back yard. He

1.     A biologist collects seeds from a pale yellow sunflower in his back yard. He grows four, to adulthood, in a greenhouse, and bags the flowers so that they are forced to self…

1. A biologist discussing the discovery of horseshoe crab fossils that date to 4

1. A biologist discussing the discovery of horseshoe crab fossils that date to 445 mya mentions that these fossils were the ancestors of horseshoe crabs living today. Which biolog…

1. A black mold is isolated from a tissue specimen. Microscopic morphology is si

1. A black mold is isolated from a tissue specimen. Microscopic morphology is simple conidiophores containing long chains of small oval conidia. The identification of this organis…

1. A carbohydrate consists of (a) amino acid units. (b) one or more sugar units.

1. A carbohydrate consists of (a) amino acid units. (b) one or more sugar units. (c) lipid droplets. (d) glycerol. 6. Rich sources of stored energy that are dissolvable in organic…

1. A cell does not have the sister chromatids properly attached to the spindle f

1. A cell does not have the sister chromatids properly attached to the spindle fibers. What statement would be true for this cell: A. it would be stuck in G1 phase B. it would be …

1. A cell must expend energy to produce a concentration gradient. ______________

1. A cell must expend energy to produce a concentration gradient. __________________ True False 1 points    QUESTION 2 A(n) closed system does not exchange energy with its surroun…

1. A cell needs to produce more Tyrosine Kinase, an enzyme, in order to break do

1. A cell needs to produce more Tyrosine Kinase, an enzyme, in order to break down certain molecules, how the cell do this? 2. Compare and contrast the different ways a cell might…

1. A cell possessing two nuclei derived from different cells through cell fusion

1. A cell possessing two nuclei derived from different cells through cell fusion is called Select one: a. recombinant. b. None of the above is correct. c. nonrecombinant. d. a het…

1. A certain protein consisting of a single polypeptide chain has a molecular we

1. A certain protein consisting of a single polypeptide chain has a molecular weight of approximately 31,000. What is the best estimate for the molecular weight of the exons on th…

1. A certain protein contains a relatively large number of arginine and lysine r

1. A certain protein contains a relatively large number of arginine and lysine residues on its surface. Which of the following can be predicted about the purification of this prot…

1. A certain type of E. coli ( bacteria), given a favorable growth medium, doubl

1. A certain type of E. coli (bacteria), given a favorable growth medium, doubles in population every 8 hours. Given that there were approximately 100 bacteria to start with, how …

1. A chemical’s solubility and persistence are two characteristics that affect h

1. A chemical’s solubility and persistence are two characteristics that affect how much harm it can cause to humans and the environment. Explain each of these terms and how they a…

1. A chemist determined the copper ion concentration in a batch of wine by forma

1. A chemist determined the copper ion concentration in a batch of wine by formation and extraction of the Cut-cuproine complex into 3-methyl-1-butanol, obtaining the data shown b…

1. A chi-square test was performed and indicated that the observed numbers of of

1. A chi-square test was performed and indicated that the observed numbers of offspring were significantly different from the expecteD. Which of the following P-values would suppo…