Biology and Genetics
101624 questions • Page 99 / 2033
1. I need to calculate and show calculation. Your plan is based on a 2000 Calori
1. I need to calculate and show calculation. Your plan is based on a 2000 Calorie allowance Nutrients l Total Calories Target 2000 Calories Average Eaten 1220 Calories 729 Status …
1. ICH Drug development guidelines are included in, explain why: a. Q7 b. Q8 c.
1. ICH Drug development guidelines are included in, explain why: a. Q7 b. Q8 c. Q7, Q8, and Q9 d. Q8 and Q10 2. CFR 210 and 211 do apply to the manufacture of, explain why a. Drug…
1. Ida parker, a 67-year-old patient, was admitted to the intensive care unit wi
1. Ida parker, a 67-year-old patient, was admitted to the intensive care unit with the diagnosis of lung cancer and underwent a left lower labectomy. The patient has a history of …
1. Identify 5 known risk factors for cardiovascular disease that cannot be chang
1. Identify 5 known risk factors for cardiovascular disease that cannot be changed. 2. What are healthy values for total cholesterol, HDL,LDL and triglyceride levels? 3. Define th…
1. Identify ONE of the locations (labeled A-K) in the East Asia map that has a h
1. Identify ONE of the locations (labeled A-K) in the East Asia map that has a high population density. (2.5 points) 2. Explain why this location has a high population density. …
1. Identify a major local, national or global environemntal problem and describe
1. Identify a major local, national or global environemntal problem and describe the role of population growth in this problem. 3+ setences 2. Some people believe our most importa…
1. Identify and describe several current environmental issues, and describe the
1. Identify and describe several current environmental issues, and describe the federal laws and regulatory agencies that exist to protect the environment. 2. List organizations a…
1. Identify and describe several current environmental issues, and describe the
1. Identify and describe several current environmental issues, and describe the federal laws and regulatory agencies that exist to protect the environment. 2. List organizations a…
1. Identify and select any topic of your interest related to public health or he
1. Identify and select any topic of your interest related to public health or health informatics, for approval 2. List down your study question, study goal, and study specific obj…
1. Identify and select any topic of your interest related to public health or he
1. Identify and select any topic of your interest related to public health or health informatics, for approval 2. List down your study question, study goal, and study specific obj…
1. Identify clinical presentation and diagnosis of Rocky Mountain spotted fever
1. Identify clinical presentation and diagnosis of Rocky Mountain spotted fever (RMSF) in patients with rapidly progressing febrile illness and recent exposure in northern Mexico,…
1. Identify each of the following statements as True or False . Focus on the und
1. Identify each of the following statements as True or False. Focus on the underlined word or phrase to decide. If the statement is False, then correct it to make it True. …
1. Identify pncations and (40 pts.) briefly explain the origin and an applicatio
1. Identify pncations and (40 pts.) briefly explain the origin and an application of each item shown below: (iv) 100 1100 7s a s0 (vi) (vii) (vii) Il: Concept mapping (10 points).…
1. Identify some switching costs in healthcare. What could a healthcare organiza
1. Identify some switching costs in healthcare. What could a healthcare organization do to minimize the impact of switching costs? 2 What are the major substitutes for hospital ca…
1. Identify the FALSE statement. Hydrothermal fluids a. may consist of hot water
1. Identify the FALSE statement. Hydrothermal fluids a. may consist of hot water, gases, or supercritical fluids. b. can accelerate metamorphic reactions. c. change a rock's chemi…
1. Identify the causative fungus of either a fungal eye infection or Pneumocysti
1. Identify the causative fungus of either a fungal eye infection or Pneumocystis pneumonia. Then: (a) Describe how the causative fungus infects the body. (b) Describe how the dis…
1. Identify the correct sequence of events from this passage. A. The concept of
1. Identify the correct sequence of events from this passage. A. The concept of "information literacy" emerged. B. The Presidential Committee on Information Literacy published a r…
1. Identify the following amino acid (at pH-7.0): (COO-)-CH(NH)CHrCH2CH2CHANH\')
1. Identify the following amino acid (at pH-7.0): (COO-)-CH(NH)CHrCH2CH2CHANH') A. glutamic acid B. glutamine C. aspartic acid D. lysine E. asparagine 2. Describe the amino acid i…
1. Identify the gene from which the query sequence originates (Name of gene) 2.
1. Identify the gene from which the query sequence originates (Name of gene) 2. Provide the FULL protein sequence encoded by the gene. 3. Are different splice variants known for t…
1. Identify the gene from which the query sequence originates (Name of gene) 2.
1. Identify the gene from which the query sequence originates (Name of gene) 2. Provide the full ... (2 bookmarks) 1. Identify the gene from which the query sequence originates (N…
1. Identify the gene from which the query sequence originates (Name of gene) 2.
1. Identify the gene from which the query sequence originates (Name of gene) 2. Provide the FULL protein sequence encoded by the gene. 3. Are different splice variants known for t…
1. Identify the likely habitats for each of the categories of prey found. If the
1. Identify the likely habitats for each of the categories of prey found. If the owl was responsible for all of the pellets, where would you say the owl was searching for fo…
1. Identify the open reading frame in the following DNA sequence, the protein th
1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. ATGAAGAAGGTTTCTACGCTTGACCTGTTGTT…
1. Identify the polypeptide that would be produced as a result of transcribing a
1. Identify the polypeptide that would be produced as a result of transcribing and translating the following DNA sequence from N-terminus to C-terminus. Template DNA: 3' GACTAAGCT…
1. Identify the roles of major nursing organizations that have an impact on nurs
1. Identify the roles of major nursing organizations that have an impact on nursing education. 2. Describe the differences between the ANA, ANCC, CCNE, N…
1. Identify the source of energy that is used in a nuclear reaction . 2. Explain
1. Identify the source of energy that is used in a nuclear reaction. 2. Explain the difference between 235U and 238U. Which is more abundant in nature? 3. …
1. Identify the structures that link thalamic nuclei with the sensorimotor corte
1. Identify the structures that link thalamic nuclei with the sensorimotor cortex. corticothalamo fiber tracts thalamocortical fiber tracts 2. The term cortex denotes an outer sur…
1. Identify the treatment that demonstrated the highest photosynthetic rate. Exp
1. Identify the treatment that demonstrated the highest photosynthetic rate. Explain why you think this is. (2 points) Time (minutes) Treatment 0 2 4 6 8 10 12 R-Value Slope …
1. Identify the way that each of the following moves in a cell. (diffusion, faci
1. Identify the way that each of the following moves in a cell. (diffusion, facilitated diffusion, active transport, cotransport) Vesicles along microtubules Microtubules in a cil…
1. Identifying the color of a bird in a tree would involve your P-type ganglion
1. Identifying the color of a bird in a tree would involve your P-type ganglion cells. True False 2. Phototransduction in rods involves the G-protein transducin. Light leads to th…
1. If 1 kg of 25°C air with 10 grams of water in it is cooled to -10°C, how much
1. If 1 kg of 25°C air with 10 grams of water in it is cooled to -10°C, how much water condenses? a. 10g b. 2g c. 23g d. 8g 2. If 1 kg of saturated 95°F air is cooled to 5°C, how …
1. If 16% of the individuals in the population have recessive phenotypes, what i
1. If 16% of the individuals in the population have recessive phenotypes, what is the percentage of heterozygous genotypes? 2. If 16% of the individuals in the population have rec…
1. If 2 genes are linked, but not completely, what will you observe, in terms of
1. If 2 genes are linked, but not completely, what will you observe, in terms of progeny classes and numbers, when an individual who is heterozygous at both loci is crossed in a t…
1. If A1 is an advantageous, dominant allele and A2 is a detrimental, recessive
1. If A1 is an advantageous, dominant allele and A2 is a detrimental, recessive allele, give the change in frequency of A1 (p) in the next generation if: p = 0.2, q = 0.8 and s = …
1. If CAP could not bind to its CAP site due to a mutation, then what would be t
1. If CAP could not bind to its CAP site due to a mutation, then what would be the reaction. Assume lactose is present in each scenario a.transcription would be difficult to repre…
1. If a cell does not get a signal to pass the G1 checkpoint, what happens? A. I
1. If a cell does not get a signal to pass the G1 checkpoint, what happens? A. It stays in G1 indefinitely B. It starts replicating its DNA C. It enters G0 phase 2. The term for t…
1. If a cell has an internal concentration of 0.8% salt and is in a solution tha
1. If a cell has an internal concentration of 0.8% salt and is in a solution that has a 0.8% salt concentration, the solution is considered to be __________ and the net water move…
1. If a cloud passes in front of the sun, Hr received by an unshaded leaf would:
1. If a cloud passes in front of the sun, Hr received by an unshaded leaf would: a.) increase b.) decrease 2. If a cloud passes in front of the sun, the temperature of an unshaded…
1. If a culture medium requires 3% (w/v) sucrose, how many grams of sucrose woul
1. If a culture medium requires 3% (w/v) sucrose, how many grams of sucrose would you add to the following amounts of medium? a. 1 liter of medium ________ b. 250 mL of medium ___…
1. If a gene locus has exactly two alleles, and the frequency of one allele in t
1. If a gene locus has exactly two alleles, and the frequency of one allele in the population is 0.07, the frequency of the other would be_ 2. The species concept focuses on caref…
1. If a grey wolf has a diploid chromosone count of 78, what is the haploid numb
1. If a grey wolf has a diploid chromosone count of 78, what is the haploid number? 2. How many chromosones are there in a full set of chromosomes in the grey wolf? 3. How many se…
1. If a plant absorbed all incoming Iight, what would it look like? The plant uw
1. If a plant absorbed all incoming Iight, what would it look like? The plant uwoutd be bloox ldaex , o eignt reptected. 2. In the past, the Calvin Cycle was called the dark react…
1. If a population comprised 52 AA, 114 Aa and 34 aa individuals and the ‘A’ all
1. If a population comprised 52 AA, 114 Aa and 34 aa individuals and the ‘A’ allele was dominant, what would be the allele, genotype and phenotype frequencies (expressed as a perc…
1. If a population doubles every 2 days, how big would thepopulation be after 10
1. If a population doubles every 2 days, how big would thepopulation be after 10 days, assuming no mortality? Assume alsothat the population starts with two individuals. What is t…
1. If a single daughter cell nucleus at the end of meiosis contains 40 nanograms
1. If a single daughter cell nucleus at the end of meiosis contains 40 nanograms (ng) of DNA then a) how many ng would have been present in one of the interkenesis nuclei? b) how …
1. If a specimen is viewed using a 45X objective in a microscope with a 15X eyep
1. If a specimen is viewed using a 45X objective in a microscope with a 15X eyepiece, how many times has the image been magnified 2. Would you use phase contrast microscopy to vie…
1. If a structural gene contains 300 DNA nucleotides, how many amino acids will
1. If a structural gene contains 300 DNA nucleotides, how many amino acids will be used in the protein synthesis? 2. If a protein has 150 amino acids, how many DNA nucleotides wou…
1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand re
1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read? 2. How are new nucleotide monomers attached to the growing strand? What is the reaction that ta…
1. If a tissue has several layers of nat C.E D. E epithelial cells, it is called
1. If a tissue has several layers of nat C.E D. E epithelial cells, it is called A. Simple squamous epithelial layer B. Stratified squamous epithelial layer C. Pseudo-stratified c…
1. If a true-breeding white flowered plant is bred with a true-breeding purple f
1. If a true-breeding white flowered plant is bred with a true-breeding purple flowered plant, what are thegenotypes of the offspring? A. heterozygous dominant B. heterozygous C. …
Subject
Biology and Genetics
Use Browse or pick another subject.