Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Biology and Genetics

101624 questions • Page 101 / 2033

1. If you want to determine if phenotype counts in your experiment deviate from
1. If you want to determine if phenotype counts in your experiment deviate from predicted counts,which test would you use? 2. In ball pythons, coral glow coloration is recessive t…
1. If you wanted to determine whether a gene was present in a mass of DNA, what
1. If you wanted to determine whether a gene was present in a mass of DNA, what would be the best tool to use to show whether that gene was present or not? a) Plasmid. b) Restrict…
1. If you were creating a library using the restriction endonucleases SbfI and E
1. If you were creating a library using the restriction endonucleases SbfI and EcoRI, for which restriction site would you design a fork-tailed adapter? Can you imagine any charac…
1. If you were creating a library using the restriction endonucleases SbfI and E
1. If you were creating a library using the restriction endonucleases SbfI and EcoRI, for which restriction site would you design a fork-tailed adapter? Can you imagine any charac…
1. If you were going to use one of the proteins to build a phylogenetic tree of
1. If you were going to use one of the proteins to build a phylogenetic tree of various mammalian species (which diverged during the last 50 million years), which protein sequence…
1. If you were in charge of distributing one-hundred million dollars in research
1. If you were in charge of distributing one-hundred million dollars in research funds but could only chose one viral disease to provide for, which disease would you endow and why…
1. If you were the privacy officer in your organization, how would you address t
1. If you were the privacy officer in your organization, how would you address the following? a. Tracking each point of access of the patient's database, including who entered the…
1. If you were to make Columbia CNA with 5% sheep blood agar plates with twice a
1. If you were to make Columbia CNA with 5% sheep blood agar plates with twice as much colistin, how would the results likely be affected? Select one: a. Less Gram-positive growth…
1. If you were to travel from Irvine, CA to Chicago when would the temperature c
1. If you were to travel from Irvine, CA to Chicago when would the temperature change you would experience be the greatest? a. If you traveled during the winter. b. If you travele…
1. IgM is the first antibody isotype secreted following activation of a naive B
1. IgM is the first antibody isotype secreted following activation of a naive B cell. IgM is found at high concentrations in the serum, and is found as a very high molecular weigh…
1. Imagine 50 black and 50 white soccer balls lined up alternatingly on the cent
1. Imagine 50 black and 50 white soccer balls lined up alternatingly on the center line of a soccer field. A player shoots one ball after another towards the goal line. Assume the…
1. Imagine a bacterial species in which the methionine (Met)operon is regulated
1. Imagine a bacterial species in which the methionine (Met)operon is regulated only by an attenuator and there is norepressor. In its mode of operation, the methionineattenuator …
1. Imagine a gene that has two alleles—the dominant wild-type A allele and the r
1. Imagine a gene that has two alleles—the dominant wild-type A allele and the recessive disease-causing mutation, called the a allele. Our population is in Hardy-Weinberg equilib…
1. Imagine a genomic researcher who is analyzing the genome of different types o
1. Imagine a genomic researcher who is analyzing the genome of different types of cats. She finds that a particular sequence in the North American Bobcat genome is exactly identic…
1. Imagine a hypothetical neuron that is permeable to only K+ ions. If the EXTRA
1. Imagine a hypothetical neuron that is permeable to only K+ ions. If the EXTRAcellular [K+] is 10 X greater than the INTRAcellular [K+], then the resting membrane potential for …
1. Imagine a prototypical receptor tyrosine kinase signaling pathway that leads
1. Imagine a prototypical receptor tyrosine kinase signaling pathway that leads to unwanted cellular proliferation and tumorigenesis when its expression increases in the cell; the…
1. Imagine a unicellular organism from another planet, which has a cytoplasm and
1. Imagine a unicellular organism from another planet, which has a cytoplasm and a plasma membrane. The cytoplasm is similar in composition to the aqueous cytoplasm of Earthly org…
1. Imagine hypothetically that the gender of a reptile is controlled by a single
1. Imagine hypothetically that the gender of a reptile is controlled by a single gene with two alleles, designated A and a. The outcome of this trait is affected by the temperatur…
1. Imagine that changes in the environment made it so that only worms remained.
1. Imagine that changes in the environment made it so that only worms remained. Predict how this might change the percentages of bird beak phenotypes seen in the population after …
1. Imagine that the star Altair has a system of three planets: Betazed, Charybdi
1. Imagine that the star Altair has a system of three planets: Betazed, Charybdis a. Which of Kepler's Laws would you use to determine the length of a year and Deneb on each plane…
1. Imagine that you have the DNA sequences from the intron of a gene in three sp
1. Imagine that you have the DNA sequences from the intron of a gene in three species called A, B, and C. Species A and B are most closely related, hile C is more distantly relate…
1. Imagine that you treat a cell with a chemical that completely inhibits the ac
1. Imagine that you treat a cell with a chemical that completely inhibits the activity of an enzyme that is critical for glycolysis, such that glycolysis is inactive in the cell. …
1. Imagine you are conducting fieldwork and discover two groups of mice living o
1. Imagine you are conducting fieldwork and discover two groups of mice living on opposite sides of a river. Design an experiment to determine whether or not these two groups belo…
1. Imagine you are doing a summer internship as a research assistant at Mountain
1. Imagine you are doing a summer internship as a research assistant at Mountain Lake Biological Station in Virginia. During your internship you observe two distinct species of bu…
1. Imagine you are researching plants and you find that the variance in flowers
1. Imagine you are researching plants and you find that the variance in flowers per plant in a wild population of the species you are studying is 90 flowers per plant. Imagine you…
1. Imagine you have engineered a set of genes, each encoding a protein with a pa
1. Imagine you have engineered a set of genes, each encoding a protein with a pair of conflicting signal sequences that specify different compartments. If the genes were expressed…
1. Imagine you have just sequenced a small bacterial (5 Points) mRNA: 5\' UCGCUG
1. Imagine you have just sequenced a small bacterial (5 Points) mRNA: 5' UCGCUGGGCUGAUGUUUGGCACGGCUCAGUUCAUGO CAAGUUCGCGUA GGCCGCUCGAAGAGCGAGUACACAGGCCCUCUUGCU AGUAGCGCUGGAUG-3 A)…
1. Immediately after the poster presentations, Aaron and Kyle decide to take an
1. Immediately after the poster presentations, Aaron and Kyle decide to take an impromptu trip to Yellowstone. It is a long drive and as they make their way up north and, Aaron (n…
1. Immunization schedules are updated annually. Go to the Centers for Disease Co
1. Immunization schedules are updated annually. Go to the Centers for Disease Control and Prevention Web site http://www.cdc.gov! and find the current immunizatiorn schedule for a…
1. Immunoglubulins _______. a Bind antigens with a 1:1 stoichiometry b Are produ
1. Immunoglubulins _______. a Bind antigens with a 1:1 stoichiometry b Are produced and secreted by macrophages c Bind tightly to their antigens d Form four classes of antibodies …
1. In 1995, the Alabama Department of Education l required all biology textbooks
1. In 1995, the Alabama Department of Education l required all biology textbooks used in the state to display a disclaimer about evolution. It has since been revised and moderates…
1. In 240 BC, Eratosthenes (c. 276 BC-c. 194 BC) measured the At Alexandria, the
1. In 240 BC, Eratosthenes (c. 276 BC-c. 194 BC) measured the At Alexandria, the midday Sun Earth's circumference and came within 95% of the modern casts a shadow indicating the S…
1. In 4HEA in the mitochondrial electron transport chain, which cofactors would
1. In 4HEA in the mitochondrial electron transport chain, which cofactors would be the first and last to be reduced by the substrate? a. 1 502 FMN and 6 201 SF4, respectively b. 6…
1. In Colorado potato beetles, wing length is a polygenic trait. A large populat
1. In Colorado potato beetles, wing length is a polygenic trait. A large population in central Idaho has a mean wing length of 12mm. A severe drought hits the state. A pest manage…
1. In DNA replication, DNA polymerase III cannot attach nucleotides directly to
1.   In DNA replication, DNA polymerase III cannot attach nucleotides directly to a chain that is already paired with the parent strand. It attaches them to an RNA primer, and the…
1. In DNA replication, the double-stranded DNA is unwound by the enzyme helicase
1. In DNA replication, the double-stranded DNA is unwound by the enzyme helicase. In PCR, the unwinding of the DNA can be accomplished by d) All the above are involved in the unwi…
1. In Drosopbila, brittle (), cbony body () and gaucho ( are three recessive gen
1. In Drosopbila, brittle (), cbony body () and gaucho ( are three recessive genes. If homozygous EBONY females are crossed with homozygous BRITTLE&GAUCHO males, the resulting…
1. In Drosophila, brittle (b), ebony body (e) and gaucho (g) are three recessive
1. In Drosophila, brittle (b), ebony body (e) and gaucho (g) are three recessive genes. If homozygous EBONY females are crossed with homozygous BRITTLE & GAUCHO males, the res…
1. In Drosophlla, two recessive alleles for the sepla locus cause flles to have
1. In Drosophlla, two recessive alleles for the sepla locus cause flles to have very dark colored eyes. Two recessive alleles at the halry locus cause the fly to have very dense b…
1. In E. Coli, two DNA polymerases synthesize the DNA in opposite directions. Th
1. In E. Coli, two DNA polymerases synthesize the DNA in opposite directions. The whole genome of E. Coli is 5 million base pair long. E. Coli replicates its whole DNA every 3000s…
1. In E. coli , plasmids are compacted through negative supercoiling just like t
1. In E. coli, plasmids are compacted through negative supercoiling just like the chromosome is compacted. Assuming there are 10.2 base pairs per helical turn, what is the linking…
1. In Early Christian art Christ is often represented as the Good Shepherd or __
1. In Early Christian art Christ is often represented as the Good Shepherd or ________ . 2. The art of the eastern half of the Roman Empire became known as ________ . 3. The cathe…
1. In Engelmann\'s classic experiment, why were the oxygen-requiring bacteria cl
1. In Engelmann's classic experiment, why were the oxygen-requiring bacteria clustered around the regions of Spirogyra algae that were bathed in red, blue, and violet light? a.Chl…
1. In Exercise 7-3 \"Antimicrobial Susceptibility Test: Disk Diffusion (Kirby-Ba
1. In Exercise 7-3 "Antimicrobial Susceptibility Test: Disk Diffusion (Kirby-Bauer) Method" several different microbes, including your El, were examined for their sensitivity to c…
1. In Humans, many types of cancers have been linked to? A. Duplications B. Inve
1. In Humans, many types of cancers have been linked to? A. Duplications B. Inversions C. translocations D. deletions E all of these 2. 5- bromoouracil is mutagenic because it is …
1. In January, off the west coast of California there is a a. low pressure cell.
1. In January, off the west coast of California there is a a. low pressure cell. b. high pressure cell. c. pirate ship. d. no pressure cell. 2. Which of the following best describ…
1. In Karst topography stalactite grows and joint a stalagmite the result is the
1. In Karst topography stalactite grows and joint a stalagmite the result is the formation of a when a a. dripstone b. tombolo c. doline d, pillar e. hydrothermal 2. The process o…
1. In Kerr and Wright\'s experiment with 96 fruit-fly populations, only 4 males
1. In Kerr and Wright's experiment with 96 fruit-fly populations, only 4 males and 4 females bred in each generation. After 16 generations, 73% of their populations had only one a…
1. In Kumquat trees, plant height is determined by 3 genes as in our simplified
1. In Kumquat trees, plant height is determined by 3 genes as in our simplified model of polygenic inheritance. Each locus has a contributing allele and a non-contributing allele.…
1. In Mendel’s monohybrid cross of purple flowered peas and white flowered peas,
1. In Mendel’s monohybrid cross of purple flowered peas and white flowered peas, all members of the F1 generation were ___________ phenotype because their genotype was ___________…