Biology and Genetics
101624 questions • Page 311 / 2033
4. Climate change, like most environmental issues, is a global challenge. To dat
4. Climate change, like most environmental issues, is a global challenge. To date, the United States has almost single- handedly derailed every international agreement on this iss…
4. Cloud seldom forms in the stratosphere because air there is very dry. Excepti
4. Cloud seldom forms in the stratosphere because air there is very dry. Exceptional is Polar Stratospheric Cloud (PSC), which forms over the Antarctic and, less fre- quently, ove…
4. Commercial biochemical test kits used to identify N. gonorrhoeae require an i
4. Commercial biochemical test kits used to identify N. gonorrhoeae require an inoculation fluid Because we are very thrifty in the Microbiology Department, we sometimes make the …
4. Compare and contrast replication, transcription, and translation by indicatin
4. Compare and contrast replication, transcription, and translation by indicating which process is described by the statement. If the statement applies to more than one, indicate …
4. Compare and contrast the Strahler & Shreve\'s River Classification Systems: b
4. Compare and contrast the Strahler & Shreve's River Classification Systems: be sure to distinguish what each was developed to measure; draw a small example of each system ca…
4. Consider a locus with two alleles, A and a. If the mutation rate from A to a
4. Consider a locus with two alleles, A and a. If the mutation rate from A to a is 8.6 x 10-4 mutations per generation and the mutation rate from a to A is 4.7 x 10-4. Given these…
4. Consider a soluble lysosomal cargo protein. A. (2pts) What is the signal that
4. Consider a soluble lysosomal cargo protein. A. (2pts) What is the signal that is recognized to deliver proteins to the lysosome? B. (4pts) How could you change the protein sequ…
4. Consider the DNA sequence below: 3’ – T A C C A A G G A G C A T T A G A T A C
4. Consider the DNA sequence below: 3’ – T A C C A A G G A G C A T T A G A T A C T – 5’ 5’ – A T G G T T C C T C G T A A T C T A T G A – 3’ a. Write the mRNA sequence that would b…
4. Consider the amplification of a DNA strand using the indicated single-strand
4. Consider the amplification of a DNA strand using the indicated single-strand DNA (ssDNA), DNA polymerase, excess primer, and a mixture of deoxynucleoside triphosphates (dNTPs) …
4. Consider the autosomal sex-influenced trait of pattern baldness (B), which is
4. Consider the autosomal sex-influenced trait of pattern baldness (B), which is dominant in men and recessive in women. A heterozygous bald (B'B) man marries a heterozygous non-b…
4. Consider the codon 5 CGU 3\' that is part of mRNA molecule produced by a prot
4. Consider the codon 5 CGU 3' that is part of mRNA molecule produced by a protein-coding gene. Which of the following mutational changes in the codon is likely to have the greate…
4. Consider the following gene structure: 2 3 4 120 150100 190 Exons are number
4. Consider the following gene structure: 2 3 4 120 150100 190 Exons are number (1-4) and sizes are given (e.g. exon 1 is of size 120 nts). The transcript can initiate (begin) at …
4. Consider the following gene structure: 2 3 4 120* 150 . 100 190 Exons are num
4. Consider the following gene structure: 2 3 4 120* 150 . 100 190 Exons are number (1-4) and sizes are given (e.g. exon 1 is of size 120 nts). The transcript can initiate (begin)…
4. Consider the following multiple sequence alignment (spaces included for ease
4. Consider the following multiple sequence alignment (spaces included for ease of reading) for the proto-insulin gene: Human: ATGGCccTGT GGATGCGCCT CCTGCCCCTG CTGGCGCTGC TGGCCCTC…
4. Consider the following multiple sequence alignment (spaces included for ease
4. Consider the following multiple sequence alignment (spaces included for ease of reading) for the proto-insulin gene Human: ATGGCCCTGT GGATGCGCCT CCTGCCCCTG CTGGCGCTGC TGGCCCTCT…
4. Consider the following set of measurements from the Mueller-Hinton antibiotic
4. Consider the following set of measurements from the Mueller-Hinton antibiotic resistance test plates. Zone diameter (mm) Antibiotic Bacteria X Bacteria Y Tetracycline 1…
4. Consider the protists, which are organisms in Domain Eukarya. Why is it inacc
4. Consider the protists, which are organisms in Domain Eukarya. Why is it inaccurate to use multicellularity as a defining characteristic for eukaryotes? (1 pt) 35. We discussed …
4. Consider the water balance in Figure 1 of Oki and Kanae (2006) as shown on th
4. Consider the water balance in Figure 1 of Oki and Kanae (2006) as shown on the bottom of page 16 in the notes (the full article is posted in this Module). 4a. What percentage o…
4. Consider two parcels of air, one in Honolulu, HI and the other in Anchorage,
4. Consider two parcels of air, one in Honolulu, HI and the other in Anchorage, AK each containing 1 kg of dry air plus some water vapor. Assume that they are both at a pressure o…
4. Consider two populations of the plant Fumaria. The number of individuals with
4. Consider two populations of the plant Fumaria. The number of individuals with each genotype is genotype: # indiv in western pop: AiAi AiA2 AiA3 A2A2 A2A3 A3A3 7 #indiv in Easte…
4. D. Archer problem #3 Chapter 4 (pg. 41). Note that the model you want to run
4. D. Archer problem #3 Chapter 4 (pg. 41). Note that the model you want to run for this problem is at: http://climatemodels.uchicago.edu/modtran/modtran.html. 15 pts 5. D. Archer…
4. DNA polymerase is positioned over the following DNA segment (which is part of
4. DNA polymerase is positioned over the following DNA segment (which is part of a much larger molecule), and is moving from RIGHT to LEFT 5... CCTTAAGACTAACTACTTACTGGGATCO . 3' o…
4. Darwin recorded uplift of 3 meters after the 1835 Chilean earthquake. That wa
4. Darwin recorded uplift of 3 meters after the 1835 Chilean earthquake. That was a subduction zone megathrustquake, with a primarily vertical component to the elastic rebound. Al…
4. Data collected during a water balance study for a fish equally able to surviv
4. Data collected during a water balance study for a fish equally able to survive in sea water and fresh water are given in the table below. These values were found after the fish…
4. Define refraction, and explain why light is refracted when traveling through
4. Define refraction, and explain why light is refracted when traveling through minerals Your answer should include the equation for frequency. (4) 5. The following information fo…
4. Dehydration will most likely cause an increase in blood pressure because of a
4. Dehydration will most likely cause an increase in blood pressure because of a. increase cardiac output b. increase viscosity c. decrease venous return d. increase resistance e.…
4. Describe a reason why there is a constraint on cell size. 1 pt In that contex
4. Describe a reason why there is a constraint on cell size. 1 pt In that context, explain how eukaryotic cells are able to be 10Xlarger than prokaryotic cells. 1 pt 5. Consider a…
4. Describe normal and abnormal heart sounds. a. What are common causes for each
4. Describe normal and abnormal heart sounds. a. What are common causes for each abnormal sound? b. What is the pathophysiology causing each of these abnormal sounds? 5. Prioritiz…
4. Describe the five cellular structures that are present in the plant cell but
4. Describe the five cellular structures that are present in the plant cell but not in the animal cell and major functions of each of those structures. 5. Where is the insulin mol…
4. Describe the location (which bone where applicable and\'or where in the body)
4. Describe the location (which bone where applicable and'or where in the body) AND function of ALL of the following: a) Hyoid b) Sella turcica c) Olecranon d) Cribriform plate e)…
4. Design a question to ask yourself about a specific neurobiological mechanism
4. Design a question to ask yourself about a specific neurobiological mechanism involved in amental disorder OR a specific neurobiological mechanism involved in producing thepharm…
4. Determine a) the content (%) of the element ofinterest contained in the follo
4. Determine a) the content (%) of the element ofinterest contained in the following minerals and b) the total value of a 100,000 short ton ore reserve for each mineral (requires …
4. Determine the latitude of the tangent rays of the Sun in the Northern Hemisph
4. Determine the latitude of the tangent rays of the Sun in the Northern Hemisphere on the following days of the year, then indicate if the latitudes north of the tangent rays in …
4. Do you think it is possible for humans to undergo sympatric speciation? Expla
4. Do you think it is possible for humans to undergo sympatric speciation? Explain. 5. Earth's different environments are constantly changing due to geologic and climatic processe…
4. Dr. Wallgruth decides that medicine is stupid, and he should switch careers i
4. Dr. Wallgruth decides that medicine is stupid, and he should switch careers into basic science. For his first project proposal, he wants to develop a model for Jane's disease. …
4. During certain stages of stages of cellular respiration, electrons are transf
4. During certain stages of stages of cellular respiration, electrons are transferred from glucose molecules to a molecule called nicotinamide adenine dinucleotide (NAD+). In this…
4. During class we discussed the following diagrams (A and B) and included a var
4. During class we discussed the following diagrams (A and B) and included a variety of terms/concepts. tail (labeling and explanation) to diagram B. that identifies the local and…
4. During inspiration, which statement is accurate for surface area and surface
4. During inspiration, which statement is accurate for surface area and surface tension? a) At inspiration, the surface area decreases; surfactants act to decrease surface tension…
4. EMERGING ADULT CHALLENGES: The time between the late teens and early twenties
4. EMERGING ADULT CHALLENGES: The time between the late teens and early twenties, referred to as “Emerging Adulthood,” has been identified as another unique period of the lifespan…
4. Effect of pH on the Conformation of -Helical Secondary Structures The unfoldi
4. Effect of pH on the Conformation of -Helical Secondary Structures The unfolding of the helix of a poly- peptide to a randomly coiled conformation is accompanied by a large decr…
4. Elastin, a muscle fiber protein, can assemble into fibers and disassemble dep
4. Elastin, a muscle fiber protein, can assemble into fibers and disassemble depending on temperature. It assembles at higher temperatures and disassembles at lower temperatures. …
4. Electrophoresis is sometimes used in clinical labs to detect major abnormalit
4. Electrophoresis is sometimes used in clinical labs to detect major abnormalities in a patient's blood proteins. To make the photo shown here, serum (the fluid of blood minus th…
4. Enamel hypoplasia is a sex-linked genetic condition in which tooth enamel is
4. Enamel hypoplasia is a sex-linked genetic condition in which tooth enamel is normally developed but extremely thin, making teeth particularly prone to wear and decay. The teeth…
4. Environmental conditions related to health: Answer majority of questions belo
4. Environmental conditions related to health: Answer majority of questions below for community Brooklyn, New York Kings county • Do you see evidence of anything that might make y…
4. Examine Table 2, from Trites and Larkin (1996). Based on the information in t
4. Examine Table 2, from Trites and Larkin (1996). Based on the information in this table, which population do you think has the greatest growth potential? Table 2: Numbers of Ste…
4. Explain how you could use pour plates to calculate the number of bacteria in
4. Explain how you could use pour plates to calculate the number of bacteria in the original liquid culture. 5. Classify each of the media used according to its functional type (i…
4. Explain the concept of infiltration capacity (i.e. infiltration capacity curv
4. Explain the concept of infiltration capacity (i.e. infiltration capacity curve). A constant low steady drizzle type rain occurs in Seattle, Washington. The soils in the region …
4. Explain the types, pathophysiology, clinical manifestations, complications, a
4. Explain the types, pathophysiology, clinical manifestations, complications, and interprofessional care (including surgical therapy and nursing management) of gastroesophageal r…
4. Explain why polar CHCly/CH3OH solvent than in acetone. subst or ionic substan
4. Explain why polar CHCly/CH3OH solvent than in acetone. subst or ionic substances, such as phospholipids, would be more soluble in a 1:1, the alumina column in the fraction as o…
4. Explain why the sky is always dark on the Moon, why a hammer and feather drop
4. Explain why the sky is always dark on the Moon, why a hammer and feather drop at the same rate of acceleration, and why craters so well preserved on the Moon, but not on the Ea…
Subject
Biology and Genetics
Use Browse or pick another subject.