Biology and Genetics

You have isolated the proteins from two other adjacent spots after 2D electropho

You have isolated the proteins from two other adjacent spots after 2D electrophoresis and digested them with? trypsin. Following MALDI-TOF mass spectrometry, the two proteins were…

You have isolated the proteins from two other adjacent spots after 2D electropho

You have isolated the proteins from two other adjacent spots after 2D electrophoresis and digested them with trypsin. Following MALDI-TOF mass spectrometry, the 2 two proteins wer…

You have isolated three different F-minus E. Coli strains, labeled A, B, and C,

You have isolated three different F-minus E. Coli strains, labeled A, B, and C, that are unable to grow on lactose as a sole carbon source (lac-).To determine which mutation is af…

You have isolated total RNA from muscle cells and constructed a muscle cDNA libr

You have isolated total RNA from muscle cells and constructed a muscle cDNA library. You wish to study the regulatory region of muscle-specific cDNA gene (gene M) that you have pr…

You have isolated two different mutants ( reg1 and reg2 ) causing constitutive e

You have isolated two different mutants (reg1 and reg2) causing constitutive expression of the emu operon (emu1 emu2). One mutant contains a defect in a DNA binding site, and the …

You have isolated two different mutants (reg1 and reg2) causing constitutive exp

You have isolated two different mutants (reg1 and reg2) causing constitutive expression of the emu operon (emu1 emu2). One mutant contains a defect in a DNAbinding site, and the o…

You have isolated two mutants of a normally pear-shaped microorganism that have

You have isolated two mutants of a normally pear-shaped microorganism that have lost their distinctive shape and are now round. One of the mutants has a defect in a protein you ca…

You have isolated two recessive mutations that affect coat color in guinea pigs.

You have isolated two recessive mutations that affect coat color in guinea pigs. The first mutation makes purple guinea pigs and the second one makes green guinea pigs. Guinea pig…

You have isolated what appears to be an intracellular parasite from a blood cult

You have isolated what appears to be an intracellular parasite from a blood culture from a human case of chronic fatigue syndrome in Chester County , Pennsylvania. Electron micros…

You have joined a lab for your Bio199 research that studies nuclear envelope bre

You have joined a lab for your Bio199 research that studies nuclear envelope breakdown (NEB) . Your project focuses on understanding if phophorylation of laminA is important for N…

You have just arrived to work and been assigned to care for three patients: A, B

You have just arrived to work and been assigned to care for three patients: A, B, and C. Selected lab work for each patient is listed below. Which patient needs to be assessed fir…

You have just been employed by a small biotech company that, among other things,

You have just been employed by a small biotech company that, among other things, sequences DNA for individual labs. Your job is to set-up and run the experiments. The first set of…

You have just been given a few cells isolated from a 5 week old embryo. These ce

You have just been given a few cells isolated from a 5 week old embryo. These cells were collected from a small sample of amniotic fluid from the womb and contain some cells from …

You have just been hired as a clinical informatics leader for a new health syste

You have just been hired as a clinical informatics leader for a new health system. The health system has 23 acute care facilities and 36 outpatient clinics. It serves as a regiona…

You have just been hired as the chief informatics officer (CIO) for a new health

You have just been hired as the chief informatics officer (CIO) for a new health system. The health system has 23 acute care facilities and 36 outpatient clinics. It serves as a r…

You have just been hired as the chief informatics officer (CIO) for a new health

You have just been hired as the chief informatics officer (CIO) for a new health system. The heal... You have just been hired as the chief informatics officer (CIO) for a new heal…

You have just been introduced to several techniques applied for advanced GIS ana

You have just been introduced to several techniques applied for advanced GIS analysis that can be used to address many issues at local, regional, and global scales. For example, w…

You have just begun guitar lessons and you notice calluses on your fingers; this

You have just begun guitar lessons and you notice calluses on your fingers; this is the result of __. Tumors are the result of __. hyperplasia, neoplasia hypertrophy, neoplasia hy…

You have just calculated the amount of GFPS65T (in mg) recovered by student Alex

You have just calculated the amount of GFPS65T (in mg) recovered by student Alex. Do you expect this to be less, more, or the same as the mg amount of GST-GFPS65T in the initial l…

You have just discovered a new antibiotic. This antibiotic is a small organic mo

You have just discovered a new antibiotic. This antibiotic is a small organic molecule that dissolves in a cytoplasmic membrane then "ferries" proteins (H+) back and forth across …

You have just discovered a new antibiotic. This antibiotic is a small organic mo

You have just discovered a new antibiotic. This antibiotic is a small organic molecule that dissolves in a cytoplasmic membrane then "ferries" protons (H+) back and forth across t…

You have just discovered a new enzyme that catalyzes the degradation of cellulos

You have just discovered a new enzyme that catalyzes the degradation of cellulose to glucose. You hope to commercialize this enzyme ultimately to invent a process for biofuel manu…

You have just discovered a new primate approximately 3.5 million years old. The

You have just discovered a new primate approximately 3.5 million years old. The foramen magnum is positioned under the center of the skull on this primate, leading you to conclude…

You have just eaten a bacon, lettuce and tomato sandwich with regular mayonnaise

You have just eaten a bacon, lettuce and tomato sandwich with regular mayonnaise on whole wheat bread. Outline in the form of a flow chart or any other way that clearly shows what…

You have just finished an exhausting genetic screen. You now want to fully chara

You have just finished an exhausting genetic screen. You now want to fully characterize one new mutation you are calling mtp. You need to determine if the mtp mutation is a nullom…

You have just finished an exhausting genetic screen. You now want to fully chara

You have just finished an exhausting genetic screen. You now want to fully characterize one new mutation you are calling mtp. You need to determine if the mtp mutation is a nullom…

You have just finished an exhausting genetic screen. You now want to fully chara

You have just finished an exhausting genetic screen. You now want to fully characterize one new mutation you are calling mtp. You need to determine if the mtp mutation is a nullom…

You have just finished drilling a 7-7/8\"vertical well on 16.0ppg fluid to 15,00

You have just finished drilling a 7-7/8"vertical well on 16.0ppg fluid to 15,000ft. The drill string is 5" 20.5ppf drill pipe: ID = 4.214in: Capacity = 0.01725bbl/ft: Displacement…

You have just isolated a new strain of Gram negative bacteria that can cataboliz

You have just isolated a new strain of Gram negative bacteria that can catabolize the sugar aspartame. Genome comparisons to all other strains don't provide any insight into the i…

You have just isolated a new strain of Gram negative bacteria that can cataboliz

You have just isolated a new strain of Gram negative bacteria that can catabolize the sugar aspartame. Genome comparisons to all other strains don't provide any insight into the i…

You have just isolated a new strain of Gram negative bacteria that can cataboliz

You have just isolated a new strain of Gram negative bacteria that can catabolize the sugar aspartame. Genome comparisons to all other strains don't provide any insight into the i…

You have just landed on a new planet and are responsible for analyzing the compo

You have just landed on a new planet and are responsible for analyzing the composition of the atmosphere. After collecting a sample of the atmosphere and analyzing it, you discove…

You have just landed on a strange, NEW planet. Your intrigue has led you to coll

You have just landed on a strange, NEW planet. Your intrigue has led you to collect and analyze a gas sample. Below are the results of your analysis, use this data to answer quest…

You have just landed your dream job as a postdoctoral fellow in a famous C. eleg

You have just landed your dream job as a postdoctoral fellow in a famous C. elegans lab. Your boss hands you a plate of hlh-6 mutant worms and tells you to figure out the function…

You have just purchased a 100-hectare wooded island in Puget Sound. Your house i

You have just purchased a 100-hectare wooded island in Puget Sound. Your house is uninsulated and built of raw timber. Although the island receives some wind, trees over 40 m tall…

You have just read a paper that the addition of caffeine to cells disrupts the D

You have just read a paper that the addition of caffeine to cells disrupts the DNA damage checkpoint and you would like to understand why. By searching for proteins that bind to c…

You have just read a paper that the addition of caffeine to cells disrupts the D

You have just read a paper that the addition of caffeine to cells disrupts the DNA damage checkpoint and you would like to understand why. By searching for proteins that bind to c…

You have just read a paper that the addition of caffeine to cells disrupts the D

You have just read a paper that the addition of caffeine to cells disrupts the DNA damage checkpoint and you would like to understand why. By searching for proteins that bind to c…

You have just sequenced a short segment of DNA. You wish to analyze this DNA seq

You have just sequenced a short segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein. 2 pts 5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAA…

You have just sequenced a short segment of DNA. You wish to analyze this DNA seq

You have just sequenced a short segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein. Answer the following questions. 5' TCAATGTAAC…

You have just started work as the health and safety professional employed by a m

You have just started work as the health and safety professional employed by a mining company that operates a camp for its Fly In/ Fly Out workforce. Workers usually work a roster…

You have just survived your \"Welcome to the Enumeration of Bacteria Thunderdome

You have just survived your "Welcome to the Enumeration of Bacteria Thunderdome" Experience in General Microbiology Lab when you happen to come across a neon orange puddle outside…

You have just won the lottery (or perhaps were chosen in the 1^st round of the N

You have just won the lottery (or perhaps were chosen in the 1^st round of the NBA draft), and are going to use some of your windfall to build yourself a dream house on the Oregon…

You have landed a great new job at a pharmaceutical company. Your job is to deve

You have landed a great new job at a pharmaceutical company.  Your job is to develop antibiotics.  A key concept in antimicrobial drug development is “selective toxicity” meaning …

You have learned that Kepler\'s third law, P2 = a3, applies to any object orbiti

You have learned that Kepler's third law, P2 = a3, applies to any object orbiting the Sun. Newton was able to derive Kepler's third law using his law of gravity. Newton's version …

You have lysed several different cell lines in order to obtain the proteins from

You have lysed several different cell lines in order to obtain the proteins from these cells. You have performed a BCA assay to quantitate the amount of protein in your cell lysat…

You have made a collection of mutant fruit flies that are defective in various a

You have made a collection of mutant fruit flies that are defective in various aspects of DNA repair. You test each mutant for its hypersensitivity to three DNA-damaging agents: s…

You have made a collection of mutant fruit flies that aredefective in various as

You have made a collection of mutant fruit flies that aredefective in various aspects of DNA repair. You test each mutantfor its hypersensitivity to three DNA-damaging agents: sun…

You have made a collection of mutant fruit flies that aredefective in various as

You have made a collection of mutant fruit flies that aredefective in various aspects of DNA repair. You test each mutantfor its hypersensitivity to three DNA-damaging agents: sun…

You have made a smear of a bacterial culture and have performed the Gram stain o

You have made a smear of a bacterial culture and have performed the Gram stain on it. Looking at the organism under the microscope, you notice that the cells do not seem to be the…