Biology and Genetics

You have read that inorganic fertilizers contribute to water pollution and would

You have read that inorganic fertilizers contribute to water pollution and would like to make a switch from inorganic fertilizers to organic compost in your vegetable garden. A fr…

You have read that inorganic fertilizers contribute to water pollution and would

You have read that inorganic fertilizers contribute to water pollution and would like to make a switch from inorganic fertilizers to organic compost in your vegetable garden. A fr…

You have read that inorganic fertilizers contribute to water pollution and would

You have read that inorganic fertilizers contribute to water pollution and would like to make a switch from inorganic fertilizers to organic compost in your vegetable garden. A fr…

You have received a package of evidence from a homicide investigation. The victi

You have received a package of evidence from a homicide investigation. The victim was found dead in his own home. There was a possible struggle and the victim was eventually stabb…

You have received a package of evidence from a homicide investigation. The victi

You have received a package of evidence from a homicide investigation. The victim was found dead in his own home. There was a possible struggle and the victim was eventually stabb…

You have received a prestigious summer research internship at the University of

You have received a prestigious summer research internship at the University of California Berkeley studying nuclear transport in yeast. Your advisor puts you on a project to deve…

You have received funding to film a 2-hour documentary on coral reef within the

You have received funding to film a 2-hour documentary on coral reef within the field of marine biology for the Discovery Channel. First, describe what the main theme of your show…

You have recently been hired as the chief financial officer (CFO) of a large hos

You have recently been hired as the chief financial officer (CFO) of a large hospital. Your hospital has experienced major groeth and is proposing a new department of quality impr…

You have recently been hired by a research team that studies cystic fibrosis (CF

You have recently been hired by a research team that studies cystic fibrosis (CF), a fatal disorder that clogs the lungs and other organs with a viscous, sticky mucous that interf…

You have recently been hired by a research team that studies cystic fibrosis (CF

You have recently been hired by a research team that studies cystic fibrosis (CF), a fatal disorder that clogs the lungs and other organs with a viscous, sticky mucous that interf…

You have recently identified a molecule that you believe to be a ligand associat

You have recently identified a molecule that you believe to be a ligand associated with a signal transduction mechanism. All you know about this ligand is that chemically it is hy…

You have reconstituted into the same membrane vesicles purified bacteriorhodopsi

You have reconstituted into the same membrane vesicles purified bacteriorhodopsin, which is a light-drive H+ pump from a photosynthetic bacterium, and purified ATP synthase from o…

You have reconstituted into the same membrane vesicles purified bacteriorhodopsi

You have reconstituted into the same membrane vesicles purified bacteriorhodopsin, which is a light-drive H+ pump from a photosynthetic bacterium, and purified ATP synthase from o…

You have recovered a strain of E. coli with a null mutation of the gene for cata

You have recovered a strain of E. coli with a null mutation of the gene for catabolite activator protein (CAP). Which of the following do you expect to be true regarding the expre…

You have removed a volume of a culture of E. coli during exponential growth in o

You have removed a volume of a culture of E. coli during exponential growth in order to measure the viable cell count. If the absorbance reading was 0.9, estimate the maximum dilu…

You have repeated the Beadle and Tatum experiments using Neurospora to find muta

You have repeated the Beadle and Tatum experiments using Neurospora to find mutants in the Arginine pathway (depicted below) and you isolate a new class of mutants. You suspect th…

You have reviewed the human genomic sequence and decided to study the function o

You have reviewed the human genomic sequence and decided to study the function of an unknown protein-coding gene. In order to start your research, you must obtain the DNA of this …

You have round polka dotted (round is dominant), and you cross this with a round

You have round polka dotted (round is dominant), and you cross this with a round solid (solid is recessive) mouse. Show all possibilities with the Punnett squares of possible offs…

You have seen that most students are able to memorize the levels of structure in

You have seen that most students are able to memorize the levels of structure in a protein-primary, secondary, tertiary, and quaternary. The question now becomes how to aid the st…

You have seen that most students are able to memorize the levels of structure in

You have seen that most students are able to memorize the levels of structure in a protein--primary, secondary, tertiary, and quaternary. The question now becomes how to aid the s…

You have seen that simple, closed systems are capable of sustaining life for 2-1

You have seen that simple, closed systems are capable of sustaining life for 2-10 years You have seen that Biosphere 2 could not sustain human life for 2 years without interventio…

You have sequenced a short fragment of DNA and it reads (from 5’ to 3’ on templa

You have sequenced a short fragment of DNA and it reads (from 5’ to 3’ on template strand): TACGGCTATCGA                                    a)         Give the sequence if the non…

You have sequenced a short fragment of DNA and it reads (from 5’ to 3’ on templa

You have sequenced a short fragment of DNA and it reads (from 5’ to 3’ on template strand): TACGGCTATCGA                                    a)         Give the sequence if the non…

You have sequenced a short piece of DNA and produced the gel shown. A. What is t

You have sequenced a short piece of DNA and produced the gel shown. A.        What is the sequence of the DNA, starting from the 5 end? B.        If you knew that this sequence is…

You have set up a cell-freetranscription system in a test tube. By mixing DNA, R

You have set up a cell-freetranscription system in a test tube. By mixing DNA, RNApolymerase, sigma factors, ribonucleotides and other essentialsubstances, you are able to make mR…

You have shotgun sequenced four related termite gut samples and obtained a total

You have shotgun sequenced four related termite gut samples and obtained a total of 40 Gbp of sequence data (10 Gbp per sample). You perform a de novo assembly of the data and wis…

You have studied mutations in a transcription regulatory protein from Bacillus s

You have studied mutations in a transcription regulatory protein from Bacillus subtilis by an in vivo reporter gene assay carried out in Escherichia coli. The cis-regulatory seque…

You have successfully completed the experiments and analyzed your results. Your

You have successfully completed the experiments and analyzed your results. Your analysis has allowed you to refine you hypothesis and remove all but one virus strain from your lis…

You have synthesized 3 new compounds and give them the names: Com1, Com2 and Com

You have synthesized 3 new compounds and give them the names: Com1, Com2 and Com3. You conduct an Ames test and determine that all three compounds are mutagenic. You then test the…

You have synthesized 3 new compounds and give them the names: Com1, Com2 and Com

You have synthesized 3 new compounds and give them the names: Com1, Com2 and Com3. You conduct an Ames test and determine that all three compounds are mutagenic. You then test the…

You have systematically mutagenized the lac operon in E. coli to produce a mutat

You have systematically mutagenized the lac operon in E. coli to produce a mutation that disrupts the function of each of the following elements: a. the promoter for LacI (P(I)) b…

You have taken on a job at a small local hospital as their EMR consultant. The I

You have taken on a job at a small local hospital as their EMR consultant. The Information Governance Committee is trying to make a decision on which EMR to purchase. They have as…

You have the following buffer recipe and decide to make up some concentrated sol

You have the following buffer recipe and decide to make up some concentrated solutions first so that you won't have to weigh out dry ingredients, wait for them to dissolve, and co…

You have the following buffer recipe and decide to make up some concentrated sol

You have the following buffer recipe and decide to make up some concentrated solutions first so that you won't have to weigh out dry ingredients, wait for them to dissolve, and co…

You have the following gene sequence that is transcribed into a complete mRNA th

You have the following gene sequence that is transcribed into a complete mRNA that encodes a small protein: 5'- TTTGATGTACCACCGCATCAGGTTTACATCATGAGTAGTTTT -3' 3*. ACTACATGGTGGCGTA…

You have the following items ready to use for making solutions: Glucose (solid;

You have the following items ready to use for making solutions: Glucose (solid; MW=180g/mol) 1M Tris HCl (liquid solution;MW= 158g/mol ) Acetone (liquid; MW=58g/mol) 10% agarose (…

You have the following sequence reads, from a genomic done of the Homo sapiens g

You have the following sequence reads, from a genomic done of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2; AAGAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAG ATGC…

You have the option of either walking (***) or driving (>>>) from your hotel m M

You have the option of either walking (***) or driving (>>>) from your hotel m Manhattan to the Met. Plot (******) the shortest walking route along the streets, ignoring …

You have the rare opportunity to establish a forest preserve that is 1000 km^2 i

You have the rare opportunity to establish a forest preserve that is 1000 km^2 in area and will be surrounded by agricultural and urban/suburban habitats. You think that detriment…

You have the same DNA in the muscle cells of your big toe as you do in the cells

You have the same DNA in the muscle cells of your big toe as you do in the cells of your pancreas and brain. What protein is used to build which cell is regulated by _____________…

You have the shown DNA strand. The restriction enzyme Mscl recognizes the consen

You have the shown DNA strand. The restriction enzyme Mscl recognizes the consensus sequence, TGG CCA. There is a second allele which contains a SNP at the location of the star. Y…

You have the thermostat in your bedroom set so the air temperature is 20 o C, bu

You have the thermostat in your bedroom set so the air temperature is 20 oC, but you’ve been having trouble sleeping.You decide to borrow a sling psychrometer from science class a…

You have theoretical evidence that a molecule derived from man-of-war jellyfish

You have theoretical evidence that a molecule derived from man-of-war jellyfish venom may have properties to lyse blood clots in humans better than the currently available medicat…

You have three guinea pigs: white, orange, and brown. You wanted to make some cr

You have three guinea pigs: white, orange, and brown. You wanted to make some crosses to determine inheritance pattern for coat color. Assume that one gene is responsible for coat…

You have three guinea pigs: white, orange, and brown. You wanted to make some cr

You have three guinea pigs: white, orange, and brown. You wanted to make some crosses to determine inheritance pattern for coat color. Assume that one gene is responsible for coat…

You have three guinea pigs: white, orange, and brown. You wanted to make some cr

You have three guinea pigs: white, orange, and brown. You wanted to make some crosses to determine inheritance pattern for coat color. Assume that one gene is responsible for coat…

You have three pairs of spheres. Pair A consists of two conducting spheres, pair

You have three pairs of spheres. Pair A consists of two conducting spheres, pair B of two nonconducting spheres, and pair C of one nonconducting sphere and one conducting sphere. …

You have three pure cultures of bacteria. One is Gram positive bacteria and the

You have three pure cultures of bacteria. One is Gram positive bacteria and the other two are Gram negative bacteria but you have mixed up the labels. You know that one of the Ent…

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using fo

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below: Primer-F:    CGTTTCCCGCCTTCAGTTTAGC Primer-R: CCCGATCTAGTAACATAGAT…

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using fo

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below: Primer-F:    CGTTTCCCGCCTTCAGTTTAGC Primer-R: CCCGATCTAGTAACATAGAT…