Biology and Genetics
101624 questions • Page 1833 / 2033
You have been promoted to the role of office manager of a healthcare administrat
You have been promoted to the role of office manager of a healthcare administration company. Prior to your assuming this role, you learn that the previous manager was lackluster a…
You have been provided with a DNA nucleotide sequence that codes for a hypotheti
You have been provided with a DNA nucleotide sequence that codes for a hypothetical protein. You will have to transcribe the code into mRNA and then translate that mRNA into the p…
You have been provided with some basic demographic data on a cohort of jumping m
You have been provided with some basic demographic data on a cohort of jumping mice in two prairie fragments in the upper Mid-West. In the Northern population, the site was burned…
You have been requested by the CIA to design a software program for a biotech la
You have been requested by the CIA to design a software program for a biotech laboratory that manufactures the ebola virus. This project is part of a bioengineering warfare progra…
You have been studying an enzyme and characterized it finding that its Km is 15.
You have been studying an enzyme and characterized it finding that its Km is 15.0 mM and the Vimax is 140 mol /min. You created a point mutation in that only one amino acid was ch…
You have been studying the effects of vitamin D on gene expression. What kind of
You have been studying the effects of vitamin D on gene expression. What kind of receptor do you expect to be involved in this response? Nuclear receptor ion channel enzyme linked…
You have been studying two Hippogriff traits as a senior graduation project at H
You have been studying two Hippogriff traits as a senior graduation project at Hogwarts (because you are magical), beak size (big beaks, B, are dominant to small beaks, b) and fea…
You have been tasked with consulting a group of environmental engineers who are
You have been tasked with consulting a group of environmental engineers who are involved in a remediation project for a chemical spill that occurred in Southern Illinois. It has b…
You have been tasked with creating a transgenic human cell line that under-expre
You have been tasked with creating a transgenic human cell line that under-expresses Rac1, a G-protein with many roles in signal transduction. Previous research has shown that a p…
You have been tasked with establishing and implementing an effective hearing con
You have been tasked with establishing and implementing an effective hearing conservation program for a metal stamping facility. Noise monitoring shows that employees working in t…
You have been tasked with isolating two different proteins from a bacterium that
You have been tasked with isolating two different proteins from a bacterium that grows at 37°C. Part I (a) The first protein you are isolating is found in the organelle of the bac…
You have been tasked with purifying Protein A. Previous experiments have determi
You have been tasked with purifying Protein A. Previous experiments have determined the following information about Protein A and the contaminating proteins (B, C, and D). Beginni…
You have been tracking a population of birds in the jungle and over several gene
You have been tracking a population of birds in the jungle and over several generations observed the following genotype frequencies for a given locus, B : 12% BB, 28% Bb, and 60% …
You have been tracking a population of birds in the jungle and over several gene
You have been tracking a population of birds in the jungle and over several generations observed the following genotype frequencies for a given locus, B : 12% BB, 28% Bb, and 60% …
You have calculated the interference value for a given mapping experiment to be
You have calculated the interference value for a given mapping experiment to be 30%. What does this mean? 70% fewer double crossovers than expected 70% more double crossovers than…
You have carried out a genetic screen in a species of fish, and have identified
You have carried out a genetic screen in a species of fish, and have identified a new gene in this organism. You have cloned and sequenced the gene, but do not know anything about…
You have checked the size of monomeric Enc on SDS-PAGE; however, you are still u
You have checked the size of monomeric Enc on SDS-PAGE; however, you are still unsure about whether or not the protein you see on the gel is your actual protein. From the followin…
You have chemically synthesized a template strand of DNA. This template strand h
You have chemically synthesized a template strand of DNA. This template strand has the sequence (CT)15 (CTCTCT…repeated 15 times for an overall 30-base sequence). You have develop…
You have cloned a Pvull fragment 3.997kb in length, and have ligated this fragme
You have cloned a Pvull fragment 3.997kb in length, and have ligated this fragment into the vector pQE16(3.768kb in length), creating a new plasmid. However, the orientation of th…
You have cloned four partial cDNAs that encode a transcription factor into a pla
You have cloned four partial cDNAs that encode a transcription factor into a plasmid that will generate a recombinant protein when expressed in bacteria. The partial cDNAs extend …
You have cloned the cDNA of a pump protein from human stomach cells which you th
You have cloned the cDNA of a pump protein from human stomach cells which you think is a passive K^+ channel which can pump K^+ from inside the cell to the extra cellular space. T…
You have cloned the gene sequence of the novel eukaryotic protein you have named
You have cloned the gene sequence of the novel eukaryotic protein you have named Protein Bob (2,100 bp in length). You have used PCR to amplify up the Protein Bob gene from your i…
You have cloned the promoter of a mouse gene that is induced by testosterone, a
You have cloned the promoter of a mouse gene that is induced by testosterone, a steroid hormone, and have a tube of the relevant hormone-responsive transcription factor. Describe …
You have collected 6 strains of D.melanogaster. Each strain is homozygous for a
You have collected 6 strains of D.melanogaster. Each strain is homozygous for a body color mutationwhich is recessive to the wild type body color. You perform thefollowing set of …
You have completed the sequencing of many parts of the dystrophin gene. Which of
You have completed the sequencing of many parts of the dystrophin gene. Which of the following pieces can NOT be included in the final contig? (Note that some sequences were seque…
You have conducted an experiment examining the effect of a high fat diet on weig
You have conducted an experiment examining the effect of a high fat diet on weight gain in hamsters. You feed 20 hamsters a high fat diet, 20 hamsters receive a low fat diet and 2…
You have conducted an experiment examining the effect of a high fat diet on weig
You have conducted an experiment examining the effect of a high fat diet on weight gain in hamsters. You feed 20 hamsters a high fat diet, 20 hamsters receive a low fat diet and 2…
You have constructed a new reporter gene to help you find novel zebrafish mutati
You have constructed a new reporter gene to help you find novel zebrafish mutations. The reporter gene consists of several LEG/TCF binding domains in the enhancer fused to the cod…
You have constructed four different libraries: a genomic library made from DNA i
You have constructed four different libraries: a genomic library made from DNA isolated from human brain tissue, a genomic library made from DNA isolated from human muscle tissue,…
You have constructed phospholipid vesicles that contain Na+/K+ pumps as the sole
You have constructed phospholipid vesicles that contain Na+/K+ pumps as the sole membrane protein. The portion of the pump that normally faces the cytosol is oriented towards the …
You have created a Ti plasmid with a T-DNA containing the left border, an NPT II
You have created a Ti plasmid with a T-DNA containing the left border, an NPT II gene, an opine synthesis gene, and a right border. Among the plants transformed with this T-DNA, y…
You have created an in vitro artificial cell system to study the formation of la
You have created an in vitro artificial cell system to study the formation of lamellipodia and cell migration (crawling). You have a membrane-bound structure that contains necessa…
You have created some artificial membrane vesicles that have a higher ph inside
You have created some artificial membrane vesicles that have a higher ph inside the aqueous solution outside. To sample 1 of these vesicles you add HCL and to the other sample you…
You have cultivated an unknown organism from a pond sediment sample and have obt
You have cultivated an unknown organism from a pond sediment sample and have obtained its ssu-rRNA sequence. After running a couple of prelin Chlorobium clathratiforme Chlorobium …
You have decided to go to graduate school for Molecular Biology (yay!). Your fir
You have decided to go to graduate school for Molecular Biology (yay!). Your first project involves investigating the regulation of expression of a gene suspected to be involved i…
You have decided to go to graduate school for Molecular Biology (yay!). Your fir
You have decided to go to graduate school for Molecular Biology (yay!). Your first project involves investigating the regulation of expression of a gene suspected to be involved i…
You have determined the primary sequence of a protein with the following charact
You have determined the primary sequence of a protein with the following characteristics: a- Amino acids 1-10: (1) leucine. (2) Threonine. (3) Valine. (4) alanine. (5) glutamate. …
You have determined the primary sequence of a protein with the following charact
You have determined the primary sequence of a protein with the following characteristics: a- Amino acids 1-10: (1) Leucine. (2) Threonine. (3) Valine. (4) alanine. (5) glutamate. …
You have determined the sequence of a cDNA clone to be: TATAAACTGGACAACCAGTTCGAG
You have determined the sequence of a cDNA clone to be: TATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCAGAAGATCCTAACGCTGACGTACGTAGACAAGTTGATAGATGATGTGCATCGGCTGTTTCGAGACAAGTA Since …
You have determined the sequence of a cDNA clone to be: TATAAACTGGACAACCAGTTCGAG
You have determined the sequence of a cDNA clone to be: TATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCAGAAGATCCTAACGCTGACGTACGTAGACAAGTTGATAGATGATGTGCATCGGCTGTTTCGAGACAAGTA Since …
You have developed 6 Principal Components using 6 bands of a Landsat ETM+ image
You have developed 6 Principal Components using 6 bands of a Landsat ETM+ image (excluding band 6, which is the thermal band). The following table shows the correlation of each Pr…
You have developed a mouse strain called XYZ that models the autiimmune disease
You have developed a mouse strain called XYZ that models the autiimmune disease pemphigus, where autoantibodies are made that destroy the tight junctions in the dermis, resulting …
You have developed a mouse strain called XYZ that models the autiimmune disease
You have developed a mouse strain called XYZ that models the autiimmune disease pemphigus, where autoantibodies are made that destroy the tight junctions in the dermis, resulting …
You have developed a mouse strain called XYZ that models the autiimmune disease
You have developed a mouse strain called XYZ that models the autiimmune disease pemphigus, where autoantibodies are made that destroy the tight junctions in the dermis, resulting …
You have developed a new food additive that is supposed to help food to stay fre
You have developed a new food additive that is supposed to help food to stay fresh longer as it sits acarcinogen). You before you can use this additive you must prove that it is s…
You have developed a novel antibiotic, which you intend to call Hulkomycin in ho
You have developed a novel antibiotic, which you intend to call Hulkomycin in honor of your favorite superhero. You decide to study its mechanism of inhibition using a poly-ribonu…
You have discovered a membrane transporter that mediates the import of Leucine i
You have discovered a membrane transporter that mediates the import of Leucine into the cytosol from the bloodstream. It utilizes the electrochemical gradient of Cl- to pump Leuci…
You have discovered a membrane transporter that mediates the import of leucine i
You have discovered a membrane transporter that mediates the import of leucine into the cytosol from the bloodstream. It utilizes the electrochemical gradient of Cl- to pump leuci…
You have discovered a membrane transporter that mediates the import of leucine i
You have discovered a membrane transporter that mediates the import of leucine into the cytosol from the bloodstream. It utilizes the electrochemical gradient of Cl- to pump leuci…
You have discovered a new area of the brain in the parietal lobe called the Shno
You have discovered a new area of the brain in the parietal lobe called the Shnoxocampus that seems to be responsible for “selfiness”. If I wanted to see if taking an excessive nu…
Subject
Biology and Genetics
Use Browse or pick another subject.