Biology and Genetics
101624 questions • Page 212 / 2033
16) Which complex, extra-cellular, contaminates surfaces? prokaryotic structure
16) Which complex, extra-cellular, contaminates surfaces? prokaryotic structure complicates antibiotic treatment and Pilus 17) How can a bacterium directly uptake a DNA molecule f…
16) Which complex, extra-cellular, prokaryotic structure complicates antibiotic
16) Which complex, extra-cellular, prokaryotic structure complicates antibiotic treatment and contaminates surfaces? Biofilm Capsid Pilus Envelope Fimbriae 17) How can a bacterium…
16) Which type of tissue forms a communication A) nervous and cou ruination syst
16) Which type of tissue forms a communication A) nervous and cou ruination system within tive body C) epithelial D) connective E) muscle 17) Suppose would now up more distinctly,…
16) With Orographic precipitation, rainfall will occur on the slope and the rain
16) With Orographic precipitation, rainfall will occur on the slope and the rainshadow (dry air) will occur on the a. Leeward; windward b. Windward; leeward c. Windward; windward …
16) With Orographic precipitation, rainfall will occur on the slope and the rain
16) With Orographic precipitation, rainfall will occur on the slope and the rainshadow (dry air) will occur on the a. Leeward; windward b. Windward; leeward c. Windward; windward …
16) in a normal healthy person an increase in cardiac output will decrease: a) t
16) in a normal healthy person an increase in cardiac output will decrease: a) the size of zone 3 in the lung, b) systemic arterial pressure, c) pulmonary vascular resistance, d) …
16,17,18 If a blood research laboratory is attempting to collect the content of
16,17,18 If a blood research laboratory is attempting to collect the content of human red blood cells, the researchers should use which of the following types of solutions to caus…
16- When the body is deficient in oxaloacetate a) acetyl CoA from the b-oxdiatio
16- When the body is deficient in oxaloacetate a) acetyl CoA from the b-oxdiation pathway cannot enter the citric acid cycle b) oxaloacetate is diverted to gluconeogenesis c) acet…
16- factors aid the organism in the process of causing infection. These include
16- factors aid the organism in the process of causing infection. These include enzymes, pili for attachment and tissue degrading factors. a) Disease b) Virulence c) Cosmic d) All…
16-20. For each of the pedigrees below, select ALL the possible (even if unlikel
16-20. For each of the pedigrees below, select ALL the possible (even if unlikely) modes of inheritance for the trait represented by shading. Assume that all women are XX and all …
16-38 The growth factor RGF stimulates proliferation of cultured rat cells. The
16-38 The growth factor RGF stimulates proliferation of cultured rat cells. The receptor that binds RGF is a receptor tyrosine kinase called RGFR. Which of the following types of …
16-5Thinking It Through Craig Segal is a recently graduated licensed vocational
16-5Thinking It Through Craig Segal is a recently graduated licensed vocational nurse (LVN) who has been hired at an oncology clinic in his home town. Craig works with patients wh…
16-8 The movements of single motor-protein molecules can be analyzed directly. U
16-8 The movements of single motor-protein molecules can be analyzed directly. Using polarized laser light, it is pos sible to create interference patterns that exert a centrally …
16-HIFU procedures require image guidance. Which of the following imaging modali
16-HIFU procedures require image guidance. Which of the following imaging modalities are typically used for image-guidance in HIFU procedures? a. B-mode imaging with contrast agen…
16-What is the chemical composition of slime layer or capsule A. Polypeptides B.
16-What is the chemical composition of slime layer or capsule A. Polypeptides B. Polysaccharides C. Fats D. Nucleic acids 17- Which of the following is FALSE about bacteria? A. th…
16-What is the chemical composition of slime layer or capsule A. Polypeptides B.
16-What is the chemical composition of slime layer or capsule A. Polypeptides B. Polysaccharides C. Fats D. Nucleic acids 17- Which of the following is FALSE about bacteria? A. th…
16. (2 points) A hypothetical scenario: some anti-retroviral drugs used to treat
16. (2 points) A hypothetical scenario: some anti-retroviral drugs used to treat HIV infected patients have been clinically shown to cause type I diabetes in these patients upon l…
16. (2 pts). You have growth on all three plats (MAC, BAP, CNA). You decide to p
16. (2 pts). You have growth on all three plats (MAC, BAP, CNA). You decide to pick the bright pink colonies off of your MAC and get the following results. KIA is yellow/yellow wi…
16. (20 pts). Aspartate carbamoyltransferase (ATCase) is catalyzes the first com
16. (20 pts). Aspartate carbamoyltransferase (ATCase) is catalyzes the first committed step of pyrimidine biosynthesis. It is typically found as a catalytic tri-mer. The graph of …
16. (2pts) The enzyme arginine-tRNA synthetase requires three substrates-ATP, tR
16. (2pts) The enzyme arginine-tRNA synthetase requires three substrates-ATP, tRNA, and the amino acid arginine.The Km values for these substrates are 300 uM, 0.4 uM and 3uM, resp…
16. A class of drugs known as receptor tyrosine kinase inhibitors (RTKIs) inhibi
16. A class of drugs known as receptor tyrosine kinase inhibitors (RTKIs) inhibit signaling from RTK receptors. Which of the following could be a mechanism for how these drugs wor…
16. A macromolecule that regulates the fluidity of animal cell membranes by stif
16. A macromolecule that regulates the fluidity of animal cell membranes by stiffening the membrane at higher temperatures and the freezing at lower temperature. preventing the me…
16. A mutation in the I gene produces a repressor which is not able to bind lact
16. A mutation in the I gene produces a repressor which is not able to bind lactose. This will lead to: a. permanent blockage of transcription. b. lactose catabolism. c. exon shuf…
16. A person whosediet excludes all animal products from the diet isa ___. (Poin
16. A person whosediet excludes all animal products from the diet isa ___. (Points : 1) 17. A personwhose diet excludes meat, poultry, and fish, but includes eggs anddairy …
16. A primitive meteorite is one that a) was found a long time ago b) fell a lon
16. A primitive meteorite is one that a) was found a long time ago b) fell a long time ago but found only recently c) contains mostly iron Ad) left the asteroid belt a long time a…
16. A thereby alteringto e in the partial pressure of oxygen causes pulmonary ar
16. A thereby alteringto e in the partial pressure of oxygen causes pulmonary arterioles to 8to make gas exchange more efficient. n increas a. Constrict; perfusion b. Dilate; perf…
16. After thorough analysis of the short stretch of DNA below, one will be able
16. After thorough analysis of the short stretch of DNA below, one will be able to identify embedded within it………… GGTGAGCGATTCGGTAGCCTCCATTCGTTAGCGTAGGCCGCGGCCGGCGCTCGAGCCACACACA…
16. Although you are an experimentally gifted graduate student, you are so busy
16. Although you are an experimentally gifted graduate student, you are so busy doing experiments that you have a hard time keeping up with the literature, meaning you aren’t alwa…
16. Based on the picture below, answer the following T/F questions. Explain your
16. Based on the picture below, answer the following T/F questions. Explain your answer. a. The two chromosomes on the left (#1) are homologous to the chromosomes on the right (#2…
16. Below is a region of DNA (sense strand) showing the base sequence T A T G T
16. Below is a region of DNA (sense strand) showing the base sequence T A T G T G T G C A A T a. Give the base sequence for mRNA transcribed from the DNA; assume no introns. b. Gi…
16. By definition, procaryotic cells do not possess_ A) a nucleus- C) ribosomes
16. By definition, procaryotic cells do not possess_ A) a nucleus- C) ribosomes D) membrane bilayers 17. Which of the following organelles has both an outer and an inner membrane?…
16. Compare and contrast transcription and translation. 17. Draw a diagram showi
16. Compare and contrast transcription and translation. 17. Draw a diagram showing a DNA sequence, the transcribed RNA sequence, this transcribed RNA sequence translated into a po…
16. Compare and contrast transcription and translation. 17. Draw a diagram showi
16. Compare and contrast transcription and translation. 17. Draw a diagram showing a DNA sequence, the transcribed RNA sequence, this transcribed RNA sequence translated into a …
16. Damage to the temporal lobe of the cerebrum would limit A. voluntary skeleta
16. Damage to the temporal lobe of the cerebrum would limit A. voluntary skeletal muscle contraction. 8. integration of cerebral activities. C. hearing. D. vision. 17. Which of th…
16. Define relative values for atmospheric pressure, intrapulmonary (intra-alveo
16. Define relative values for atmospheric pressure, intrapulmonary (intra-alveolar) pressure, intrapleural pressure and transpulmonary pressure 17. Describe Boyle’s Law. Relate B…
16. Define relative values for atmospheric pressure, intrapulmonary (intra-alveo
16. Define relative values for atmospheric pressure, intrapulmonary (intra-alveolar) pressure, intrapleural pressure and transpulmonary pressure 17. Describe Boyle’s Law. Relate B…
16. Discard the flow through from the collection tube as described above. 17. Ce
16. Discard the flow through from the collection tube as described above. 17. Centrifuge the spin filter at 10,000 xg for I minute at room temperature to remove any residual liqui…
16. Divisions of the cerebral hemispheres that are named after the overlying sku
16. Divisions of the cerebral hemispheres that are named after the overlying skut are a. fissures b. sinuses c. lobes d. sulci e. gyri 17. The visual cortex is located in the a. f…
16. Draw the products of the following transesterification: excess CH OH 17. Som
16. Draw the products of the following transesterification: excess CH OH 17. Some questions about amino acids and proteins: COOH i. Consider the Fischer projection of the amino ac…
16. Empty magnification occurs when (A) a microscope without lenses is used. (B)
16.Empty magnification occurs when (A) a microscope without lenses is used. (B) the size of an image increases with no increase in resolution. (C) the size of an image increase…
16. Equalization of the amount of expression of X lnked genes in males and femal
16. Equalization of the amount of expression of X lnked genes in males and females is accomplished via random X chromosome inactivation in females i all species. A) TRUE B) FALE w…
16. Explain why geographic variation in garter snake prey choice might indicate
16. Explain why geographic variation in garter snake prey choice might indicate that the behavior evolved by 17. Describe the following behaviors that influence survival and repro…
16. Fatty acid A has\'10 double covalent bonds scattered throughout its carbon c
16. Fatty acid A has'10 double covalent bonds scattered throughout its carbon chain while fatty acid B has only single covalent bonds between the carbons in its chain. A. Fatty ac…
16. For pea plants, pods can be either full or constricted in shape and green or
16. For pea plants, pods can be either full or constricted in shape and green or yellow in color. A true-breeding plant with constricted/green pods is crossed with a true breeding…
16. For which of the following types of dysrhythmia is amiodarone approved? a. A
16. For which of the following types of dysrhythmia is amiodarone approved? a. Atrial b. Ventricular c. Junctional d. Supraventricular 17. Which of the following describe the card…
16. Fronts are found in ________ between air masses where temperature and moistu
16. Fronts are found in ________ between air masses where temperature and moisture gradients _________. a. transition zones, are typically small b. ridges, do not exist c. transit…
16. Gene transfer that requires cell-to-cell cont A. transformation. B. transduc
16. Gene transfer that requires cell-to-cell cont A. transformation. B. transduction. C. conjugation D. functional genomics. act is 17. All the bacterial cells that result from th…
16. Given the following conditions and a sufficient amount of lift, would you ex
16. Given the following conditions and a sufficient amount of lift, would you expect to experience thunderstorms, supercells, and numerous/strong tornadoes? CAPE: 2,000 J/kg Surfa…
16. Here is a genetic circuit: the first sub-circuit (promoter-operon) turns on
16. Here is a genetic circuit: the first sub-circuit (promoter-operon) turns on the production of a protein which inhibits the transcription of the second sub-circuit (promoter-op…
16. How much of your 5M stock do you need to make the final concentration be 50m
16. How much of your 5M stock do you need to make the final concentration be 50mM NaCl 17 how much of a 6x dye do you need to add to a 20ul digest to dilute the loading dye down t…
Subject
Biology and Genetics
Use Browse or pick another subject.