Biology and Genetics
101624 questions • Page 278 / 2033
3. (2 pts) Determine how fast the Southern Ocean is spreading between Australia
3. (2 pts) Determine how fast the Southern Ocean is spreading between Australia and Antarctica: Remember that cm-centimeters, km-kilometers, my-millions of years, yr -years Rememb…
3. (2 pts) What does the \"c\" in cdk stands for? a. Cancer b. Checkpoint c. Coc
3. (2 pts) What does the "c" in cdk stands for? a. Cancer b. Checkpoint c. Cockatoo d. Cyclin e. Cytoplasm 4. (2 pts) What enzyme attaches phosphates to substrates? a. Adenylyl cy…
3. (2 pts.) Many animals such as worms and snails are hermaphrodites. a. Describ
3. (2 pts.) Many animals such as worms and snails are hermaphrodites. a. Describe what it means to be a hermaphrodite. b. Many hermaphrodites cannot self-fertilize; they still nee…
3. (2) After graduation, you and 19 of your closest friends (lets say 10 males a
3. (2) After graduation, you and 19 of your closest friends (lets say 10 males and 10 females including you) charter a plane to go on a round-the-world tour. Unfortunately, your p…
3. (20 points) You are given the assignment of developing a new plasmid for gene
3. (20 points) You are given the assignment of developing a new plasmid for genetic engineering which contains resistance for kankamycin and ampicillin. Your advisor suggests that…
3. (20 pt) In March 2014, an unusually strong surface low-pressure system moved
3. (20 pt) In March 2014, an unusually strong surface low-pressure system moved across the state of Pennsylvania. At 21Z on March 12, 2014, the central pressure of the low had dro…
3. (22 points) Cancer as a contagion. The cancer cells of Tasmanian Devil Facial
3. (22 points) Cancer as a contagion. The cancer cells of Tasmanian Devil Facial Tumor Disease (DFTD) are infectious and can be spread to an uninfected animal through the bite fro…
3. (25 pts) Short answers-Individual Activity a) The completion of the Human Gen
3. (25 pts) Short answers-Individual Activity a) The completion of the Human Genome Project in less than the number of years projected was the development of new and the advanceme…
3. (2pts) Photosynthesis is a redox reaction. In the light-reaction of photosynt
3. (2pts) Photosynthesis is a redox reaction. In the light-reaction of photosynthesis, molecule is oxidized? I reduced? what n the dark-reaction (Calvin Cycle) of photosynthesis, …
3. (3 points) An atom with an atomic number of 1 has an effective radius of 0.87
3. (3 points) An atom with an atomic number of 1 has an effective radius of 0.875 mm. What is the energy level of this atom? What is its energy? 4. (2 points) If the average life …
3. (30%) (closed system, steady state) Consider a lake having the following prop
3. (30%) (closed system, steady state) Consider a lake having the following properties: Lake volume 3.1 x 10m3 Suspended solids (SS): 1 m3 of SS/ 105 m3 water Biota: 31 m3 SS/wate…
3. (4 points total) Below is a copy of the coding strand of DNA for a gene. CTGA
3. (4 points total) Below is a copy of the coding strand of DNA for a gene. CTGATGCAGCCGCATCGCAGATGCGTAGTTCATTTGCTGGATAACGACAGCGCTAT 3 a. (0.5 points) Draw out the non-coding stra…
3. (4 points) Every enzyme works at its highest efficiency at a particular pH. F
3. (4 points) Every enzyme works at its highest efficiency at a particular pH. For example, the enzymes in the lysosome in the cell (most all of which are involved in protein degr…
3. (4 points) You have a patient that has trisomy 13 syndrome (Patau\'s syndrome
3. (4 points) You have a patient that has trisomy 13 syndrome (Patau's syndrome). Please answer the following questions a. (1 point) During which specific stages of meiosis could …
3. (4 pts) You have learned about a number of genes that play roles in Alzheimer
3. (4 pts) You have learned about a number of genes that play roles in Alzheimer’s Disease (AD), such as uracil glycosylase, MED12, APP, PEN-2, and NEP. Pick one of these genes, a…
3. (4pts each) Suppose you expose cells to drugs with the following effects. Wil
3. (4pts each) Suppose you expose cells to drugs with the following effects. Will these tend to promote microtubule growth, shrinkage, or neither? Please provide a brief explanati…
3. (4pts each) Suppose you expose cells to drugs with the following effects. Wil
3. (4pts each) Suppose you expose cells to drugs with the following effects. Will these tend to promote microtubule growth, shrinkage, or neither? Please provide a brief explanati…
3. (4pts each) Suppose you expose cells to drugs with the following effects. Wil
3. (4pts each) Suppose you expose cells to drugs with the following effects. Will these tend to promote microtubule growth, shrinkage, or neither? Please provide a brief explanati…
3. (4pts each) Suppose you expose cells to drugs with the following effects. Wil
3. (4pts each) Suppose you expose cells to drugs with the following effects. Will these tend to promote microtubule growth, shrinkage, or neither? Please provide a brief explanati…
3. (5 points) match the description or example with the lipid classification. On
3. (5 points) match the description or example with the lipid classification. One distinctive or major classification per description or example fatty acid . triacylglycerol phosp…
3. (5 pts) The chemical properties of hormones restricts the manner in which the
3. (5 pts) The chemical properties of hormones restricts the manner in which they are handled. Assign the features below as primary characteristics of either the amino-acid based …
3. (5 pts.) You are asked to determine how many colony forming units are found i
3. (5 pts.) You are asked to determine how many colony forming units are found in 100 grams of soil. You begin by mixing 1 gram of the soil into water, totaling 100 ml in volume. …
3. (6 points) Below figure shows three temperature-sensitive (ts) yeast mutants,
3. (6 points) Below figure shows three temperature-sensitive (ts) yeast mutants, Mut-A, Mut-B, and Mut-C. Each yeast culture was first grown at permissive temperature (22-C) and t…
3. (6 points) In which of the listed ecological functions do fungi outperform pr
3. (6 points) In which of the listed ecological functions do fungi outperform prokaryotes and which of the listed features describe best why this superior performance is possible?…
3. (6 points). Fungi are major decomposers and therefore play an important role
3. (6 points). Fungi are major decomposers and therefore play an important role in making organic material available in ecosystems. Which of the listed traits is unique to fungi (…
3. (6) Match the description on the left with the molecule on the right. High en
3. (6) Match the description on the left with the molecule on the right. High energy bond on ATP a Ester linkage b Proine cGlycosidic bond Bond that links amino acids Results from…
3. (60 pts) The Na/K ATPase maintains the electrochemical gradient required for
3. (60 pts) The Na/K ATPase maintains the electrochemical gradient required for nerve impulses. Nerve cells expend about 70% of their ATP production on maintaining the Na' and K g…
3. (6pts ea GDP. Plea provide a brief explanation (2 sentences max). cnj Suppose
3. (6pts ea GDP. Plea provide a brief explanation (2 sentences max). cnj Suppose the following GTPases are mutated so that they permanently bind to se predict the location where t…
3. (6pts each) Suppose the following GTPases are mutated so that they permanentl
3. (6pts each) Suppose the following GTPases are mutated so that they permanently bind to GDP. Please predict the location where the stated cargo proteins would accumulate, and pr…
3. (6pts each) Suppose the following GTPases are mutated so that they permanentl
3. (6pts each) Suppose the following GTPases are mutated so that they permanently bind to GDP. Please predict the location where the stated cargo proteins would accumulate, and pr…
3. (6pts each) Suppose the following GTPases are mutated so that they permanentl
3. (6pts each) Suppose the following GTPases are mutated so that they permanently bind to GDP. Please predict the location where the stated cargo proteins would accumulate, and pr…
3. (7 points) The enzyme asparaginase has been used to treat people with certain
3. (7 points) The enzyme asparaginase has been used to treat people with certain types of leukemia. This treatment only works for tumor cells that require asparagine for growth…
3. (8 points) Carboxymethyl cellulose is a water-insoluble material consisting o
3. (8 points) Carboxymethyl cellulose is a water-insoluble material consisting of cellulose with carboxylmethyl groups attached to it as shown to the right. Suppose a mixture of t…
3. (8 points) You are studying a mutation of a signaling protein. The mutant pro
3. (8 points) You are studying a mutation of a signaling protein. The mutant protein is completely nonfunctional and is shorter than wild type. The mutant mRNA, however, is signif…
3. (8 points) You are studying a mutation of a signaling protein. The mutant pro
3. (8 points) You are studying a mutation of a signaling protein. The mutant protein is completely nonfunctional and is shorter than wild type. The mutant mRNA, however, is signif…
3. (8 points). If you discover two mutants for flower color in plants, how can y
3. (8 points). If you discover two mutants for flower color in plants, how can you determine if they involve the same gene or different genes? 4. (12 points). In bunny rabbi A B g…
3. (Based on Ch. 4 #5) Budgie parakeets come in green, yellow, blue, and albino
3. (Based on Ch. 4 #5) Budgie parakeets come in green, yellow, blue, and albino color forms, as a result of the actions of two pigment-producing genes, one Yellow and the other Bl…
3. (a) Briefly compare and contrast the different types of restriction explain w
3. (a) Briefly compare and contrast the different types of restriction explain why Type II is the most useful in molecular biology. (b) Suggest condition(s) that may lead to parti…
3. (a) Construct a karyotype(see back of this page) of the chromosomes from the
3. (a) Construct a karyotype(see back of this page) of the chromosomes from the normal human cell 3) as directed in the protocol. Attach the chromosomes to the last page of the La…
3. (a) Construct a karyotype(see back of this page) of the chromosomes from the
3. (a) Construct a karyotype(see back of this page) of the chromosomes from the normal human cell 3) as directed in the protocol. Attach the chromosomes to the last page of the La…
3. 1 points SerCP11 17.P.008. My Notes Ask Your Te An aluminum wire having a cro
3. 1 points SerCP11 17.P.008. My Notes Ask Your Te An aluminum wire having a cross-sectional area of 4.90 x 10-6 m2 carries a current of 3.50 A. The density of aluminum is 2.70 g/…
3. 3. A geneticist wants to isolate mutants in mice that are defective in nucleo
3. 3. A geneticist wants to isolate mutants in mice that are defective in nucleotide excision repair (NER) but is unable to do biochemical analysis on the NER system so must use s…
3. 9 points total) In a study of the codominant blood typing alleles, L M and L
3. 9 points total) In a study of the codominant blood typing alleles, LM and LN in a population of mice on Island A, it was found that there were 165 MM blood types 870 MN and 965…
3. A 2006 genetic study of a large American family attempted to identify genetic
3. A 2006 genetic study of a large American family attempted to identify genetic linkage between DNA markers (A and B) to the gene producing the autosomal dominant disorder spinoc…
3. A 42-year-old divorced school teacher has a 20-year-old daughter who has deve
3. A 42-year-old divorced school teacher has a 20-year-old daughter who has developed schizophrenia and has withdrawn from college. Her youngest daughter is a 19-year-old, unmarri…
3. A 52 year-old male arrives at your clinic because recently he attempted to fl
3. A 52 year-old male arrives at your clinic because recently he attempted to fly for the first time in his life. At the airport, he set the metal detector off even though he was …
3. A 57-year-old moderately overweight Caucasian male visits his family physicia
3. A 57-year-old moderately overweight Caucasian male visits his family physician with a symptom of "indigestion" of 5 days' duration. He has also had bouts of sweating, malaise, …
3. A B C D Your summer job is breeding mice for a scientist at the University of
3. A B C D Your summer job is breeding mice for a scientist at the University of Chicago. You are given two true-breeding mice. One is white, has pink eyes, a long tail, thick fur…
3. A carbon atom of mass number 12 and a carbon atom of mass number 14 are A) co
3. A carbon atom of mass number 12 and a carbon atom of mass number 14 are A) covalent B) compounds C) ions D) isotopes 4. A chlorine atom has 17 proton…
3. A cladogram based on physical morphologies was created to show the evolutiona
3. A cladogram based on physical morphologies was created to show the evolutionary relationships between several species. Later, DNA sequences were obtained for the same gene in t…
Subject
Biology and Genetics
Use Browse or pick another subject.