Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Biology and Genetics

101624 questions • Page 1843 / 2033

You notice that you cannot read your book through a test tube of fluid held agai
You notice that you cannot read your book through a test tube of fluid held against the print, making it so blurred as to be unreadable. There is no precipitant in the bottom of t…
You notice your cat itching-fleas! She has a rapidly expanding, continuously gro
You notice your cat itching-fleas! She has a rapidly expanding, continuously growing population of fleas in her fur. The growth rate for this population is 0.8 individuals per day…
You now know everything you need to know to be an informed critic of the Afforda
You now know everything you need to know to be an informed critic of the Affordable Care Act. Based on all that you have learned, how does the Act measure up to our three goals of…
You observe a thin section containing a colored, chemically homogeneous uniaxial
You observe a thin section containing a colored, chemically homogeneous uniaxial mineral. As you rotate the stage in plane polarized light, you notice the following 3 scenarios: 9…
You observe dwarfed truffula trees (a different species from those discussed in
You observe dwarfed truffula trees (a different species from those discussed in the Dr. Seuss book, the Lorax) in two different areas. In area one, the average of the heights are …
You observe dwarfed truffula trees (a different species from those discussed in
You observe dwarfed truffula trees (a different species from those discussed in the Dr. Seuss book, the Lorax) in two different areas. In area one, the average of the heights are …
You observe dwarfed truffula trees (a different species from those discussed in
You observe dwarfed truffula trees (a different species from those discussed in the Dr. Seuss book, the Lorax) in two different areas. In area one, the average of the heights are …
You observe high resolution images of a newly studied moon of Saturn with no sig
You observe high resolution images of a newly studied moon of Saturn with no significant atmosphere. you notice that the surface is overall smooth, very few craters and some rifts…
You observe that your patients treated by a soluble form of the CD28 co-stimulat
You observe that your patients treated by a soluble form of the CD28 co-stimulatory molecule (that is expressed on T cells) experience prolonged allogeneic kidney graft survival. …
You observe the following numbers of individuals of each genotype in a populatio
You observe the following numbers of individuals of each genotype in a population:                         AA                              Aa                               aa     …
You observe the following phenotypic ratio in the F2 of the maize cross describe
You observe the following phenotypic ratio in the F2 of the maize cross described in Part A: 100 long-stalked, colored seed plants: 10 long-stalked, colorless seed plants 10 short…
You observe two female fish of the same species breeding one female lays 100 egg
You observe two female fish of the same species breeding one female lays 100 eggs and the other female lay 1000 eggs. Which one of the following most likely given the trade-offs? …
You observe two populations of the same species of fish, but each population occ
You observe two populations of the same species of fish, but each population occurs in a different environment. Females of each population are approximately the same size, but fem…
You observed that a high dilution of a young culture was plated on a medium know
You observed that a high dilution of a young culture was plated on a medium known to support its growth, but after 48 hours of incubation, the plate showed no growth. Give two pos…
You obtain 7 homozygous mutant lines of geckos that all lack spots (normal gecko
You obtain 7 homozygous mutant lines of geckos that all lack spots (normal geckos have spots). After three years of work breeding them to one another in pairwise combinations you …
You obtain a DNA sample from your patient and send it io a lab for sequencing. T
You obtain a DNA sample from your patient and send it io a lab for sequencing. They send back the following sequence of pro-insulin. Compare the sequence of the normal gene to tha…
You obtain a DNA sample from your patient and send it to a lab for sequencing. T
You obtain a DNA sample from your patient and send it to a lab for sequencing. They sequence of pro-insulin. Compare the sequence of the normal gene to that of the patients. a) Wh…
You obtain a mouse mutant in which the skin is severely blistered. The mutation
You obtain a mouse mutant in which the skin is severely blistered. The mutation maps near the gene encoding the alpha6 integrin protein. a. Why would a mutation in integrin cause …
You obtain the following studies: An ECHOCARDIOGRAM shows a thin LV wall, an enl
You obtain the following studies: An ECHOCARDIOGRAM shows a thin LV wall, an enlarged LV, and severe hypokinesis of the septum and lateral wall of the LV. The visually estimated E…
You obtain the sequence of a gene containing 10 exons, 9 introns, and a 3\' UTR
You obtain the sequence of a gene containing 10 exons, 9 introns, and a 3' UTR containing a polyadenylation consensus sequence. The fifth intron also contains a polyadenylation si…
You only need to select one case study: You are speaking to an older adult who y
You only need to select one case study: You are speaking to an older adult who you believe has a hearing impairment. They do not currently wear a hearing aid. They also wear glass…
You ordered an oligonucleotide primer (GCGTGGATCCATGTTTGCGG) from a company name
You ordered an oligonucleotide primer (GCGTGGATCCATGTTTGCGG) from a company named Invitrogen-Life Technologies. The company provides you with the oligonucleotide in a lyophilized …
You ordered an oligonucleotide primer (GCGTGGATCCATGTTTGCGG) from a company name
You ordered an oligonucleotide primer (GCGTGGATCCATGTTTGCGG) from a company named Invitrogen-Life Technologies. The company provides you with the oligonucleotide in a lyophilized …
You over hear two students discussing the topic of Doppler shift d Student 1: \"
You over hear two students discussing the topic of Doppler shift d Student 1: "Sin red Betelgeuse is a red star, it must be going away from us, and since Rigel is a blue star it m…
You perform a Kirby-Bauer assay, but you neglect to use aseptic technique. Your
You perform a Kirby-Bauer assay, but you neglect to use aseptic technique. Your plate becomes contaminated with a bright red organism. You can easily tell this organism apart from…
You perform a bacterial transformation experiment with two strains. One strain i
You perform a bacterial transformation experiment with two strains. One strain is a+ b+ c+ d+, and the other is a- b- c- d-. You begin by randomly shearing the chromosomal DNA of …
You perform a case-control study investigating potential risk factors for a new
You perform a case-control study investigating potential risk factors for a new type of pneumonia to strike Atlanta, GA. From preliminary evaluations, you suspect that the disease…
You perform a colorimetric enzyme assay to determine the activity of invertase i
You perform a colorimetric enzyme assay to determine the activity of invertase in a bioreactor (total volume = 1L) used to produce inverted sugar. You prepare your standard curve …
You perform a colorimetric enzyme assay to determine the activity of inverts in
You perform a colorimetric enzyme assay to determine the activity of inverts in a bioreactor (total volume = 1L) used to produce inverted sugar. You prepare your standard curve by…
You perform a cotransformation mapping experiment using two strains of E. coli.
You perform a cotransformation mapping experiment using two strains of E. coli. The first strain has the genotype a- b- c-. The second strain has the genotype a+ b+ c+. The result…
You perform a cross between two true-breeding strains of zucchini. One has green
You perform a cross between two true-breeding strains of zucchini. One has green fruit and the other has yellow fruit. The F1 plants are all green, but when these are crossed, the…
You perform a generalized transduction experiment, where phages are collected fr
You perform a generalized transduction experiment, where phages are collected from an S. aureus donor strain of genotype abc+ def+ ghi+, then used to transduce a recipient of geno…
You perform a generalized transduction experiment, where phages are collected fr
You perform a generalized transduction experiment, where phages are collected from an S. aureus donor strain of genotype abc+ def+ ghi+, then used to transduce a recipient of geno…
You perform a laboratory experiment where you place a piece ofskeletal muscle in
You perform a laboratory experiment where you place a piece ofskeletal muscle in a calcium-free medium. What would happen if youdepolarize the muscle membrane? What would happen i…
You perform a laboratory experiment where you place a piece ofskeletal muscle in
You perform a laboratory experiment where you place a piece ofskeletal muscle in a calcium-free medium. What would happen if youdepolarize the muscle membrane? What would happen i…
You perform a second experiment, in which you add SRP to your cell-free protein-
You perform a second experiment, in which you add SRP to your cell-free protein-synthesizing system, and find that translation stops after a polypeptide about 70 amino acids long …
You perform a series of experiments on the synthesis of the pituitary hormone pr
You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a single polypeptide chain 199 amino acids long. In the first experiment, the mRN…
You perform a series of experiments on the synthesis of the pituitary hormone pr
You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a single polypeptide chain 199 amino acids long. In the first experiment, the mRN…
You perform a series of experiments on the synthesis of the pituitary hormone pr
You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a single polypeptide chain 199 amino acids long. The mRNA coding for prolactin is…
You perform a series of experiments on the synthesis of the pituitary hormone pr
You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a single polypeptide chain 199 amino acids long. In the first experiment, the mRN…
You perform a southern blot on ClaI-digested chromosomal DNA extracted from five
You perform a southern blot on ClaI-digested chromosomal DNA extracted from five different streptomycin resistant colonies to identify which has undergone a transformation event a…
You perform a statistical test (e.g., chi-square) and find that the observed and
You perform a statistical test (e.g., chi-square) and find that the observed and expected genotype frequencies are different. How would you interpret your results? a. This populat…
You perform a trihybrid test cross for an individual of genotype A/a . B/b. D/d
You perform a trihybrid test cross for an individual of genotype A/a . B/b. D/d You obtain the following phenotypes of offspring (in numerical order): ABd: 422 abD: 406 aBD: 53 AB…
You perform a western press blot to detect albumin from rat serum You are convin
You perform a western press blot to detect albumin from rat serum You are convinced that you did every single step of the protocol perfectly. Yet, when you did the color developme…
You perform a western-press-blot o detect albumin from rat serum. You are convin
You perform a western-press-blot o detect albumin from rat serum. You are convinced that you did every single step of the protocol perfectly, Yet, when you did the color developme…
You perform an experiment in which chromatin is isolated from sea urchin sperm c
You perform an experiment in which chromatin is isolated from sea urchin sperm cells and briefly digested with micrococcal nuclease. When chromatin proteins are removed and the re…
You perform an experiment where you take tRNA molecules each with a histidine at
You perform an experiment where you take tRNA molecules each with a histidine attached to it, and replace the histidine with glycine. These new hybrid tRNA molecules are then adde…
You perform electrophoresis on the product of a PCR and see that instead of the
You perform electrophoresis on the product of a PCR and see that instead of the 300-baseband you expected that there are five different bands. What controls the specific sequence …
You perform qPCR to determine expression levels of miR-102 in human multiple mye
You perform qPCR to determine expression levels of miR-102 in human multiple myeloma cancer cells (MM). After looking at the data (shown), you decide to look for targets of miR-10…
You perform spirometry with Helium Dilution on a male aged 56 years with a 40 ye
You perform spirometry with Helium Dilution on a male aged 56 years with a 40 year cigarette smoking history of 2 packs/day. Patient complains of lingering cough and production of…