Biology and Genetics

1) Why is the mass of the earth important to maintain life as we know it? A) If

1) Why is the mass of the earth important to maintain life as we know it? A) If the earth's mass were significantly different, we would be bombarded by cosmic rays that would stri…

1) Why is the mass of the earth important to maintain life as we know it? A) If

1) Why is the mass of the earth important to maintain life as we know it? A) If the earth's mass were significantly different, we would be bombarded by cosmic rays that would stri…

1) Why is there a concentration gradient of NaCl in the medulla? A) There is mor

1) Why is there a concentration gradient of NaCl in the medulla? A) There is more NaCl as the filtrate leaves then ascending limb compared to when it enters the ascending limb. B)…

1) Why is there a concentration gradient of NaCl in the medulla? A) There is mor

1) Why is there a concentration gradient of NaCl in the medulla? A) There is more NaCl as the filtrate leaves then ascending limb compared to when it enters the ascending limb. B)…

1) With how many bacteria should you inoculate a broth if you wish to obtain 327

1) With how many bacteria should you inoculate a broth if you wish to obtain 32768 bacteria after 24 hours? Assume that the bacteria double every 3 hours? 2)There are initially 2 …

1) Women born with an extra X chromosome (XXX) are healthy and phenotypically in

1) Women born with an extra X chromosome (XXX) are healthy and phenotypically indistinguishable from normal XX women. What is a likely explanation for this finding? How could you …

1) Would the A, B, or C soil horizon typically have the greatest number of micro

1) Would the A, B, or C soil horizon typically have the greatest number of microorganisms? Click on the correct soil horizon in the soil profile picture below. A: Moderately deep …

1) Write a composition explaining the origins of our Universe, using the followi

1) Write a composition explaining the origins of our Universe, using the following terms in your narrative. Do not copy/paste from Internet sources, and use boldface or capitalize…

1) Write the chemical equations for the three reactions in the citric acid cycle

1) Write the chemical equations for the three reactions in the citric acid cycle in which NADH is produced, including the enzymes involved. None of these reactions involves molecu…

1) Write the possible genotypes of the two parents in each of these pairings. Li

1) Write the possible genotypes of the two parents in each of these pairings. List all blood groups to which children of each of the following pairs of parents could belong. Find …

1) Y. pestis can be transmitted directly and indirectly between hosts. A. True B

1) Y. pestis can be transmitted directly and indirectly between hosts. A. True B. False 2) Microfold cells are a part of ___________. A. The stomach B. The cardiovascular system C…

1) Yeast are grown in a closed flask in a lighted room. There is an abundance of

1) Yeast are grown in a closed flask in a lighted room. There is an abundance of glucose, oxygen, and carbon dioxide in the flask. (A) What will happen to the amount of oxygen in …

1) Yellow coat color in mice is dominant, and a mouse carrying a dominant (Y) al

1) Yellow coat color in mice is dominant, and a mouse carrying a dominant (Y) allele at the yellow gene will always be yellow, no matter what alleles they have at other genes. Ano…

1) You and a friend were in a minor bike accident - fell off your tandem bicycle

1) You and a friend were in a minor bike accident - fell off your tandem bicycle - and you are taking drugs to try and relieve your pain and swollen toes. Your friend takes Ibupro…

1) You and a friend were in a minor bike accident -fell off your tandem bicycle

1) You and a friend were in a minor bike accident -fell off your tandem bicycle - and you are taking drugs to try and relieve your pain and swollen toes. Your friend takes Ibuprof…

1) You are doing FRET and you excite a protein tagged with blue fluorescent prot

1) You are doing FRET and you excite a protein tagged with blue fluorescent protein with 360 nm light and it emits ight with a wavelength of 450 nm. which of the following fluores…

1) You are exposed to influenza viruses, and alas, you have not yet had your inf

1) You are exposed to influenza viruses, and alas, you have not yet had your influenza vaccine this year! Unfortunately, the viruses manage to bind successfully to epithelial cell…

1) You are famous ecologist conducting a mark-recapture study of a populati have

1) You are famous ecologist conducting a mark-recapture study of a populati have collected the following mark/recapture /release data in your study. Using the Peterson Index with …

1) You are feeding your pet 0.85 kg of feed that contains 4078 Kcal/kg of energy

1) You are feeding your pet 0.85 kg of feed that contains 4078 Kcal/kg of energy and 40% CP. How many Kcals are they getting? How many kg of CP are they getting? 2.) Your pet’s ta…

1) You are interested in gene X and analyzed gene X by PCR (with enzyme digestio

1) You are interested in gene X and analyzed gene X by PCR (with enzyme digestion), a Northern blot (i.e., looking at all transcripts corresponding to gene X), a Western blot (i.e…

1) You are interested in gene X and analyzed gene X by PCR (with enzyme digestio

1) You are interested in gene X and analyzed gene X by PCR (with enzyme digestion), a Northern blot (ie, looking at all transcripts corresponding to gene X), a Western blot (i.e. …

1) You are testing some new fluorescent stains to see if they could help tell yo

1) You are testing some new fluorescent stains to see if they could help tell you about how the endomembrane system and the secretory pathway worked. For each of the following sta…

1) You are working in a group studying Bananaquit coloration. You find a gene th

1) You are working in a group studying Bananaquit coloration. You find a gene that promotes bright color: B. If you are using population genetics analysis for your study, how woul…

1) You are working in a large city hospital emergency room. Two men have been br

1) You are working in a large city hospital emergency room. Two men have been brought in from a homeless shelter. Both are complaining about fatigue, weight loss and general malai…

1) You are working in the hospital lab and have a blood smear from a patient wit

1) You are working in the hospital lab and have a blood smear from a patient with no visible platelets. What is likely wrong with this inidivdual? he/she has malaria he/she is HIV…

1) You discover a fossil of an extinct mammal high in the Andes. Would you predi

1) You discover a fossil of an extinct mammal high in the Andes. Would you predict that this mammal would be more closely related to present-day mammals living in the South Americ…

1) You have 100 ml of a solution of ATP. You take 25 ?l, and dilute it to a fina

1) You have 100 ml of a solution of ATP. You take 25 ?l, and dilute it to a final volume of 1ml. The absorbance of the diluted solution at 259 nm is 0.550. a) What is the ATP conc…

1) You have a new aquarium for S hamu the Killer Whale that contains 1,000,000 p

1) You have a new aquarium for S hamu the Killer Whale that contains 1,000,000 pounds of ocean water with a salinity of 30 o/oo (ppt) by weight. a. How many pounds of salt are in …

1) You have a stock of 100 mg/mL ampicillin in sterile water. You want to make a

1) You have a stock of 100 mg/mL ampicillin in sterile water. You want to make a 25 mg/mL stock in sterile water. What is your dilution factor? 2) You take 2 mL of spoiled chicken…

1) You have extracted your targeted plasmid from Milariuza. equilirus in your ho

1) You have extracted your targeted plasmid from Milariuza. equilirus in your home. Because you do not have an expensive nanodrop machine, you decided to run a gel to determine th…

1) You have found a population of wild rabbits with a uniform grey coat color. Y

1) You have found a population of wild rabbits with a uniform grey coat color. You suspect that the grey allele is recessive to normal coat color and dominant to chinchilla. Predi…

1) You have identified a channel that is involved in pumping of Fe2+ ions into t

1) You have identified a channel that is involved in pumping of Fe2+ ions into the liver cell. The channel appears to be regulated by a gating mechanism. You wish to verify that c…

1) You have integrated the wildtype yeast URA1 gene into random chromosomal loca

1) You have integrated the wildtype yeast URA1 gene into random chromosomal locations of Mat alpha budding yeast cells that cannot grow on media lacking Uracil. Below are the grow…

1) You have integrated the wildtype yeast URA1 gene into random chromosomal loca

1) You have integrated the wildtype yeast URA1 gene into random chromosomal locations of Mat alpha budding yeast cells that cannot grow on media lacking Uracil. Below are the grow…

1) You have isolated ten new mutants that have eye defects; assume that each mut

1) You have isolated ten new mutants that have eye defects; assume that each mutant only has one mutation and all mutations are recessive. To place them into complementation group…

1) You have isolated ten new mutants that have eye defects; assume that each mut

1) You have isolated ten new mutants that have eye defects; assume that each mutant only has one mutation and all mutations are recessive. To place them into comple make mate each…

1) You have isolated two proteins that you suspect are new actin capping factors

1) You have isolated two proteins that you suspect are new actin capping factors that may cap either the lus or minus ends of the filaments. To determine if this is the case and w…

1) You have just been hired at a new start-up that has developed an intravenous

1) You have just been hired at a new start-up that has developed an intravenous (IV) injectable small molecule drug (OP145) to treat osteoporosis. During pre-clinical trials, it w…

1) You have two unknown, unlabeled clear solutions. One is DNA and the other is

1) You have two unknown, unlabeled clear solutions. One is DNA and the other is protein. How do you determine which solution is DNA, which one is protein 2)In an SDS gel larger pr…

1) You have used primary antibodies raised in mouse (for GAPDH, 35.8 kda) and in

1) You have used primary antibodies raised in mouse (for GAPDH, 35.8 kda) and in rabbit (for Cyt P450 reductase, 77 kDa) followed by a treatment with 2 types secondary antibodies …

1) You innoculate the following bacteria in thioglycolate medium and allow them

1) You innoculate the following bacteria in thioglycolate medium and allow them to grow overnight at 37 degrees in the incubator. Next day you observe their growth patterns. Indic…

1) You innoculate the following bacteria in thioglycolate medium and allow them

1) You innoculate the following bacteria in thioglycolate medium and allow them to grow overnight at 37 degrees in the incubator. Next day you observe their growth patterns. Indic…

1) You need to mix 35L of artificial seawater. You\'re handed a bag of crystalli

1) You need to mix 35L of artificial seawater. You're handed a bag of crystallized salt mix and you're told seawater typically has a salt concentration of 35 mg/L. How much salt m…

1) You need to prepare 30mls of Master Mix Cocktail composed of: 0.15M CAP buffe

1) You need to prepare 30mls of Master Mix Cocktail composed of: 0.15M CAP buffer 6mM NAD 0.15M sodium lactate In the cabinet, you have the following ingredients: a) a stock solut…

1) You prepared 2 plasmids by a mini-prep method, diluted the final solutions 1:

1)    You prepared 2 plasmids by a mini-prep method, diluted the final solutions 1:50, and using a spectrophotometer and standard cuvette, you determined the UV absorbances at 260…

1) You read a paper that says, “The symbiotic alpha-proteobacterium that first t

1) You read a paper that says, “The symbiotic alpha-proteobacterium that first took up residence in an early eukaryote would have had a genome that codes for at least 500 proteins…

1) You sent off a sample for sequencing in order to aid in prescribing the prope

1) You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back: a. TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCG…

1) You sequence a gene of interest and isolate the matching mRNA. You find that

1) You sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that? a) There was an experimental m…

1) You study a deadly disease in your community; Methicillin-resistant Staphyloc

1) You study a deadly disease in your community; Methicillin-resistant Staphylococcus aureus (MRSA). It is usually contracted in in-patient facilities. The following information w…

1) You use the Bradford (coomassie) assay to determine the concentration of a wh

1) You use the Bradford (coomassie) assay to determine the concentration of a whey protein. You use bovine albumin as your standard. You determine the histone protein concentratio…