Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse G

Alphabetical listing with fast deep pagination.
13318 items • Page 45 / 267

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Gender-selection methods are somewhat controversial. Some people believe that us
Gender-selection methods are somewhat controversial. Some people believe that use of such methods should be prohibited, regardless of the reason. Others believe that limited use s…
Gender: Randomly Chosen? A large community college district has 1000 teachers, o
Gender: Randomly Chosen? A large community college district has 1000 teachers, of whom 50% are men and 50% are women. In this district, administrators are promoted from among the …
GenderSelection: In a test of the MicroSofrt method of genderselection, 51 babie
GenderSelection: In a test of the MicroSofrt method of genderselection, 51 babies are born to couples trying to have baby boys,and 39 of those babies are boys. If the gender selec…
Gene A and B are separated by 26 m.u. on the x chromosome of Drosophila. You col
Gene A and B are separated by 26 m.u. on the x chromosome of Drosophila. You collect individual Drosophila from nature and isolate five different X chromosomes. You make heterozyg…
Gene A and B are separated by 26 m.u. on the x chromosome of Drosophila. You col
Gene A and B are separated by 26 m.u. on the x chromosome of Drosophila. You collect individual Drosophila from nature and isolate five different X chromosomes. You make heterozyg…
Gene A codes for a liver enzyme and has two alleles; A1 and A2. A1A1 individuals
Gene A codes for a liver enzyme and has two alleles; A1 and A2. A1A1 individuals are normal, and produce 500 units of the functional enzyme. Allele A2 is the result of a point mut…
Gene A converts compound A (green) to compound B (blue). Gene B converts compoun
Gene A converts compound A (green) to compound B (blue). Gene B converts compound B to compound C (red). These compounds determine the color of the individual. In a self cross of …
Gene A with 4 exons, codes for a liver enzyme. This gene has three alleles; A1,
Gene A with 4 exons, codes for a liver enzyme. This gene has three alleles; A1, A2 and A3. A1A1 individuals are normal and produce 500 units of the functional enzyme. A1A3 patient…
Gene A-------------Gene B-------------Enhancer-------------Gene C-----------Insu
Gene A-------------Gene B-------------Enhancer-------------Gene C-----------Insulator-------------Gene D our genes (A, B, C, and D), an enhancer and an insulator are organized as …
Gene B located on X chromosome in quinea pigs determine either black (B allele)
Gene B located on X chromosome in quinea pigs determine either black (B allele) or orange (b allele) color. Heterozygous quinea pigs are tortoise-shell. Explain if both males and …
Gene Expression and the Impact of a Mutation I. Using the DNA coding strand sequ
Gene Expression and the Impact of a Mutation I. Using the DNA coding strand sequence provided in the 5' 3, direction, predict the sequences of the DNA template strand in the 3' 5'…
Gene Expression. In studies of the human genome, gene expression levels are ofte
Gene Expression. In studies of the human genome, gene expression levels are often studied to investigate patterns that might identify certain diseases. Consider three different ge…
Gene I interacts with gene D to determine the blood phenotypes of humans. Gene I
Gene I interacts with gene D to determine the blood phenotypes of humans. Gene I is the gene for ABO blood phenotypes in humans, and includes three alleles: I^A, I^B and i. Gene D…
Gene Johnson, who worked for Cable Fixers, Inc. for 21 years, was terminated whe
Gene Johnson, who worked for Cable Fixers, Inc. for 21 years, was terminated when he was 69 years old and was replaced by a much younger man who Cable Fixers paid a significantly …
Gene M encodes a polypeptide with 324 amino acids. A mutation has changed codon
Gene M encodes a polypeptide with 324 amino acids. A mutation has changed codon 134 of this gene to UAA, producing allele m1. How many amino acids are in the polypeptide coded by …
Gene M encodes a polypeptide with 324 amino acids. A mutation has changed codon
Gene M encodes a polypeptide with 324 amino acids. A mutation has changed codon 134 of this gene to UAA, producing allele m1. How many amino acids are in the polypeptide coded by …
Gene Mapping Assignment Instructions For this gene mapping project, you will map
Gene Mapping Assignment Instructions For this gene mapping project, you will map the HBB hemoglobin, beta (Homo sapiens) gene with Gene ID: 3043. In order to map the gene and obta…
Gene Maps- Practice Sack Gray bodies in flies are dominant over gray bodies. Nor
Gene Maps- Practice Sack Gray bodies in flies are dominant over gray bodies. Normal wings are dominant over vestig al wings and red eyes are dominant over purple eyes. Using the i…
Gene Regulation Discussion Term List Use the vocab terms listed below to fill in
Gene Regulation Discussion Term List Use the vocab terms listed below to fill in the blanks Positive control Gene expression Operon Negative regulator (repressor) Inducible operon…
Gene Regulation Quiz Schedule: Available now.Due 09/27/2015 11:59 PM EDT Questio
Gene Regulation Quiz Schedule: Available now.Due 09/27/2015 11:59 PM EDT Question 1 Select one answer. 10 points Which of the following terms describes the macromolecule that carr…
Gene Regulation in Prokaryotes – Lac Operon E. COLI MUTATIONS Use the figure abo
Gene Regulation in Prokaryotes – Lac Operon E. COLI MUTATIONS Use the figure above depicting a wild type operon (a) and examples of mutation (b-d) to answer the following question…
Gene Regulation in Prokaryotes- Lac Operon ECOLIMUTATIONS Use the figure below d
Gene Regulation in Prokaryotes- Lac Operon ECOLIMUTATIONS Use the figure below depicting a wild type operon (a) and examples of mutation (b-d) to answer the following questions. c…
Gene Regulation in Prokaryotes-Lac Operon (4 pts) Describe what is happening in
Gene Regulation in Prokaryotes-Lac Operon (4 pts) Describe what is happening in the following scenario to the repressor, operator, cAMP production, CAP, CAP binding site, RNA poly…
Gene Replacement in both yeast and mouse embryonic stem cells involves: A. Trans
Gene Replacement in both yeast and mouse embryonic stem cells involves: A. Transposable Elements B. Site specific recombination C. Homologous recombination D. Gene Conversion E. n…
Gene Sequence AACGCGGGAAGCAGGGGCGGGGCCTCTGGTGGCGGTCGGGAACTCGGTGGGAGGCGGCAA CATTG
Gene Sequence AACGCGGGAAGCAGGGGCGGGGCCTCTGGTGGCGGTCGGGAACTCGGTGGGAGGCGGCAA CATTGTTTCAAGTTGGCCAAATTGACAAGAGCGAGAGGTATACTGCGTTCCATCCCGACC CGGGGCCACGGTACTGGGCCCTGTTTCCCCCTCCTCGGCCCCC…
Gene Simmons Company uses normal costing in each of its three manufacturing depa
Gene Simmons Company uses normal costing in each of its three manufacturing departments. Manufacturing overhead is applied to production on the basis of direct labor cost in Depar…
Gene Splicing - 1. DNA is made up of two separate strands of base sequences. The
Gene Splicing - 1. DNA is made up of two separate strands of base sequences. The same sequence is found on both strands, but running in opposite directions. What word describes th…
Gene Therapy As you near the end of the term, you will put everything together y
Gene Therapy As you near the end of the term, you will put everything together you have learned and discuss an important application of genetics: gene therapy. The overall goal of…
Gene W that undergoes independent assortment affect fruit color in summer squash
Gene W that undergoes independent assortment affect fruit color in summer squash. This gene has two alleles, one of which (W) is dominant for fruit color, allele W code for white …
Gene X encodes a repressor that represses gene Y, which also encodes a repressor
Gene X encodes a repressor that represses gene Y, which also encodes a repressor. Both X and Y negatively regulate their own promoters. (a) At time t=0, X begins to be produced at…
Gene X encodes an enzyme that is expressed in the skin, the brain and the heart.
Gene X encodes an enzyme that is expressed in the skin, the brain and the heart. Skinny, brainy, hearty are three genes that encode three tissue-specific transcription factors tha…
Gene X has a point mutation resulting in a premature stop codon in the mRNA. Ima
Gene X has a point mutation resulting in a premature stop codon in the mRNA. Imagine one cell line with this mutant was wild type (for all non Gene X genes) while another had a mu…
Gene X of Bacteriophage UCLA is required for generating small plaques on a lawn
Gene X of Bacteriophage UCLA is required for generating small plaques on a lawn of E. coli. Gene X mutants make a large plaque. The entire mRNA sequence of a wild type Gene X is s…
Gene and chromosomal mutations can alter phenotype. How it affects phenotype wil
Gene and chromosomal mutations can alter phenotype. How it affects phenotype will depend on where the mutation occurs. Based on the given locations of mutations, provide the possi…
Gene captain and gene spike work together to promote gene expression. I want to
Gene captain and gene spike work together to promote gene expression. I want to express these two gene products in cells and run a GFP reporter assay to determine if they work ind…
Gene captain and gene spike work together to promote gene expression. I want to
Gene captain and gene spike work together to promote gene expression. I want to express these two gene products in cells and run a GFP reporter assay to determine if they work ind…
Gene captain and gene spike work together to promote gene expression. I want to
Gene captain and gene spike work together to promote gene expression. I want to express these two gene products in cells and run a GFP reporter assay to determine if they work ind…
Gene captain and gene spike work together to promote gene expression. I want to
Gene captain and gene spike work together to promote gene expression. I want to express these two gene products in cells and run a GFP reporter assay to determine if they work ind…
Gene drives i. What is the difference between a gene drive and daisy drive? ii.
Gene drives i. What is the difference between a gene drive and daisy drive? ii. What is the goal of daisy quorum drive? Synthetic biology i. What are the two goals of synthetic bi…
Gene expression in prokaryotes and eukaryotes is similar in many respects and di
Gene expression in prokaryotes and eukaryotes is similar in many respects and different in others. Select all answers that apply to BOTH eukaryotes AND prokaryotes. (Choose three …
Gene expression is often assayed by measuring the level of mRNA produced from a
Gene expression is often assayed by measuring the level of mRNA produced from a gene. If one is interested in knowing the amount of a final active gene product, a potential proble…
Gene expression: Understand the question on DNA coding and mutational consequenc
Gene expression: Understand the question on DNA coding and mutational consequence as shown in the lecture slide. What are the subcellular locations for DNA replication, transcript…
Gene families are groups of paralogous genes ( e.g. hemoglobins, olfactory recep
Gene families are groups of paralogous genes ( e.g. hemoglobins, olfactory receptors and opsin photoreceptors). How are these paralogous genes related? A. They are the same DNA se…
Gene flow is an evolutionary factor associated with: a. artificial selection b.
Gene flow is an evolutionary factor associated with: a. artificial selection b. random mating c. increased mutations d. migration of individuals e. small populations Evolution occ…
Gene frequencies for the ABO alleles vary geographically. For example the I^A al
Gene frequencies for the ABO alleles vary geographically. For example the I^A allele makes up nearly 50% of the genes for blood type among Australian Aborigines, about 25% in Cent…
Gene frequencies for the ABO alleles vary geographically. For example the I^A al
Gene frequencies for the ABO alleles vary geographically. For example the I^A allele makes up nearly 50% of the genes for blood type among Australian Aborigines, about 25% in Cent…
Gene frequencies for the ABO alleles vary geographically. For example the I^A al
Gene frequencies for the ABO alleles vary geographically. For example the I^A allele makes up nearly 50% of the genes for blood type among Australian Aborigines, about 25% in Cent…
Gene frequencies in small populations changes at different rates than in large p
Gene frequencies in small populations changes at different rates than in large populations. How does each of the following processes (1. selection, 2. migration, 3. genetic drift,…
Gene homologues. Back at the top of the http://www.ncbi.nlm.nih.gov/ page, under
Gene homologues. Back at the top of the http://www.ncbi.nlm.nih.gov/ page, under the ‘All databases’ tab select the ‘Homologene’ database and enter your gene of interest into the …
Gene is the creative director for a small agency representing an insurance compa
Gene is the creative director for a small agency representing an insurance company called Safety Net Insurance. Safety Net wants a new campaign that will differ from other insuran…